View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3397_high_5 (Length: 237)
Name: NF3397_high_5
Description: NF3397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3397_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 4655410 - 4655630
Alignment:
| Q |
1 |
attagacatgaaaagctttacaaacctaaaagtgcaaagccataaaggatgtgccaaaatgcagtaataaaaaggtctcaagatatttgcaacaacaaac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4655410 |
attagccatgaaaagctttacaaacctaaaagtgcaaagccataaaggatgtgccaaaatacagtaataaaaaggtctcaagatatttgcaacaacaaac |
4655509 |
T |
|
| Q |
101 |
tgattagttttagaatgaccgtctttctttatttgattcataagtgttaccttccttctctttcatttgaagtaattcataccgtctcttgtgagtttat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4655510 |
tgattagttttagaatgaccgtctttcttcatttgattcataagtgttaccttccttctctttcatttgaagtaattcataccgtctcttgtgagtttat |
4655609 |
T |
|
| Q |
201 |
aatctaaccttgtctgcatct |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
4655610 |
aatctaaccttgtctgcatct |
4655630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University