View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3397_low_7 (Length: 349)
Name: NF3397_low_7
Description: NF3397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3397_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 298
Target Start/End: Original strand, 55297736 - 55298039
Alignment:
| Q |
1 |
gaggaggatgagcgcggtgaatatcacgaacgtgacggtcctcgacaatccagcttcgtttctcaatccctttcagttcgagatttcctatgagtgtttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55297736 |
gaggaggatgagcgcggtgaatatcacgaacgtgacggtcctcgacaatccagcttcgtttctcaatccctttcagttcgagatttcctatgagtgtttg |
55297835 |
T |
 |
| Q |
101 |
gccgctctcaaagatggtatcgtttctctttactctactacttttctaacctaattcatttcttcatttatcttgctttagatcttcaa------ttttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55297836 |
gccgctctcaaagatggtatcgtttctctttactctactacttttctaacctaattcatttcttcatttatcttgctttagatcttcaattttcgttttc |
55297935 |
T |
 |
| Q |
195 |
gttttcgctgtgttaggttagggtttagggtttttcttttcagatcttgtttctgttcccaaatttgacctaattttgttagttatttagggcaccaatc |
294 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55297936 |
gttttcgctctgttaggttagggtttagggtttttcttttcagatcttgtttctgttcccaaatttgacctaattttgttagttatttagggcaccaatc |
55298035 |
T |
 |
| Q |
295 |
ctct |
298 |
Q |
| |
|
|||| |
|
|
| T |
55298036 |
ctct |
55298039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University