View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3398R-Insertion-10 (Length: 207)
Name: NF3398R-Insertion-10
Description: NF3398R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3398R-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 201
Target Start/End: Complemental strand, 43013242 - 43013049
Alignment:
| Q |
8 |
aattctctatatcggaaaagtaggattcaaagaagaataatgaaacctgaacaatgaaaacgacaacatttgatttgagtgatgagtggaaatgaacttg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43013242 |
aattctctatatcggaaaagtgggattcaaagaagaataatgaaacctggacaatgaaaacgacaacatttgatttgagtgatgggtggaaatgaacttg |
43013143 |
T |
|
| Q |
108 |
ggtgtacagaatgtcgttggtgatgagcaaagtggaaattaggtaggaatacgaagtatctaaatcacttttttgtccattctaaatcactttt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43013142 |
ggtgtacagaatgtcgttggtgatgagcaaagtggaaattaggtaggaacacgaagtatctaaatcactttttggtccattctaaatcactttt |
43013049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University