View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3398R-Insertion-9 (Length: 305)
Name: NF3398R-Insertion-9
Description: NF3398R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3398R-Insertion-9 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 9 - 305
Target Start/End: Complemental strand, 33044646 - 33044350
Alignment:
| Q |
9 |
tgttcatcagatggatttcgctatcaaacatcattttttctttagctgtaatgtggggacaatggacaaaagtgagctgttttaagtttattagataatt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33044646 |
tgttcatcagatggatttcgctatcaaacatcattttttctttagctgtaatgtggggacaatggacaaaagtgagatgttttaagtttattagataatt |
33044547 |
T |
|
| Q |
109 |
tagtcattttttcttctgccatatggttggatgggaatatatttgcactcacttaggagattagttaaaaatatgtattcaatttctgttatgcatgaat |
208 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33044546 |
tagtcattttttcttctgccatatagttggatgggaatatatttgcactcacttaggagattagttaaaaatatgtattcaatttctgttatgcatgaat |
33044447 |
T |
|
| Q |
209 |
tgaagttctcgcaagactccaacctctttaaaggtgttattatttccattatgcattgcttattgttaattgatgctatttttcctgatttggtggg |
305 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33044446 |
tgaagttctcgcaagactccaacctctttaaaggtgttattatttccattatgcattgcttattgttaattgatgctatttttcctgatttggtggg |
33044350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University