View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3401_low_1 (Length: 440)
Name: NF3401_low_1
Description: NF3401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3401_low_1 |
 |  |
|
| [»] chr7 (179 HSPs) |
 |  |
|
| [»] chr5 (171 HSPs) |
 |  |
|
| [»] chr2 (136 HSPs) |
 |  |
|
| [»] chr4 (196 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] chr8 (169 HSPs) |
 |  |
|
| [»] chr1 (179 HSPs) |
 |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] chr6 (119 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0213 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0864 (2 HSPs) |
 |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (2 HSPs) |
 |  |  |
|
| [»] scaffold1301 (1 HSPs) |
 |  |  |
|
| [»] scaffold0097 (1 HSPs) |
 |  |  |
|
| [»] scaffold0236 (1 HSPs) |
 |  |  |
|
| [»] scaffold2010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 198)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 17 - 384
Target Start/End: Complemental strand, 53319162 - 53318794
Alignment:
| Q |
17 |
atatatttgaaaaacatggtcaatgaatattatgtatatatatttgaactcttggcattnnnnnnnnnntt-gaactcctgaaaaatcttgtatattaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |
|
|
| T |
53319162 |
atatatttgaaaaacatggtcaatgaatattatgtatatatatttgaactcttgccattaaaaaagaaatttgaactcctgaaaaatcttgtatattaga |
53319063 |
T |
 |
| Q |
116 |
acatagtttggatgattattgagtatgtgtatatttgttgaacacgtgaaaatggcactcattggaaagaacaaagtttggttttgtggatgaatctttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53319062 |
acatagtttggatgattattgagtatgtgtatatttgttgaacacgtgaagatggcactcattggaaagaacaaagtttggttttgtggatgaatctttc |
53318963 |
T |
 |
| Q |
216 |
ccaactctggtggaggatgaacctctttggcgtgttatttattctacgtcgattagtcattcgaaattcattgttgattcgttgaacattaacagatagc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53318962 |
ccaactctggtggaggatgaacctctttggcgtgttatttattctacgtcgattagtcattcgaaattcattgttgattcgttgaacattaacagatagc |
53318863 |
T |
 |
| Q |
316 |
atatcttattttatccccaaccttgatgtaagcaatcacagataacaatagcaatacaaataaaataaa |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53318862 |
atatcttattttatccccaaccttgatgtaagcaatcacagatgacaatagcaatacaaataaaataaa |
53318794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 27766508 - 27766573
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27766508 |
ataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 47530661 - 47530598
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
47530661 |
aaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 37181995 - 37182059
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
37181995 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37182059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 51843123 - 51843060
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51843123 |
aaaaaaaagccttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51843060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 2239546 - 2239488
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2239546 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2239488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 17916399 - 17916341
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
17916399 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 19391627 - 19391693
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
19391627 |
aataaaacataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 53192111 - 53192169
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
53192111 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53192169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 45743897 - 45743954
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45743897 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45743954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 52916857 - 52916914
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52916857 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52916914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 8313948 - 8314004
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
8313948 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 10864114 - 10864170
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10864114 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 19392017 - 19391961
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
19392017 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 19914786 - 19914730
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
19914786 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19914730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 381 - 433
Target Start/End: Original strand, 26494681 - 26494733
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26494681 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26494733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 27748557 - 27748501
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27748557 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27748501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 27766831 - 27766775
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27766831 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 28964152 - 28964208
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
28964152 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28964208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 30200728 - 30200672
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30200728 |
aggcttaattgcacttttagactcctatctttccaaaagttgcggttatggacccct |
30200672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 30761122 - 30761058
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30761122 |
taaaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
30761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 33576731 - 33576667
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
33576731 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
33576667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42230345 - 42230289
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42230345 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42230289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 44177287 - 44177343
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
44177287 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 44183971 - 44184027
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
44183971 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 44895962 - 44895906
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
44895962 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44895906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 51336889 - 51336945
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
51336889 |
aggcttaattgcacttttggactcctatcttttcaaaagttgcggttatgaccccct |
51336945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 53532120 - 53532064
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
53532120 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53532064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 3212465 - 3212410
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
3212465 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3212410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 10864432 - 10864377
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
10864432 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatgaacccct |
10864377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 22202484 - 22202539
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22202484 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
22202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 27857448 - 27857393
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27857448 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 44184284 - 44184229
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
44184284 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 47530339 - 47530394
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
47530339 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 12881538 - 12881480
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12881538 |
ataaaatttaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
12881480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 27748242 - 27748292
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27748242 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27748292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 41722051 - 41722109
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
41722051 |
aaaggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
41722109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 42465689 - 42465739
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42465689 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
42465739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 2711699 - 2711756
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
2711699 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
2711756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 9630758 - 9630823
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| | ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
9630758 |
ataaaaaataggcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
9630823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 12881234 - 12881283
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12881234 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
12881283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 20982573 - 20982524
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20982573 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20982524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 33621864 - 33621921
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
33621864 |
aaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
33621921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 47423442 - 47423393
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47423442 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
47423393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 257750 - 257694
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
257750 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
257694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 433
Target Start/End: Complemental strand, 7858279 - 7858227
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7858279 |
taaaggcttaattgcacttttggatccctatctttccaaaagttgcggttatg |
7858227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 9633712 - 9633656
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
9633712 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
9633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 11963047 - 11962983
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| |||||||||||||||||||| | |||||| |
|
|
| T |
11963047 |
taaattaaaggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
11962983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 19914475 - 19914531
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
19914475 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
19914531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 25053897 - 25053849
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25053897 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25053849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 25126312 - 25126256
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25126312 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 25782652 - 25782708
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
25782652 |
aggcttaattgcactttttgacccctatttttccaaaagttgcggttatgaacccct |
25782708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 25782975 - 25782911
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||| ||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
25782975 |
taaaaaaaaggcttaattgcacttttagacacttatctttccaaaagttgcggttatggacccct |
25782911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 28964468 - 28964412
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28964468 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28964412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 29168720 - 29168784
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29168720 |
taaaataaagatttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29168784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 30200419 - 30200471
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
30200419 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30200471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 31117619 - 31117675
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31117619 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 33252795 - 33252743
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
33252795 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
33252743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 36441482 - 36441530
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36441482 |
ggcttaattgcacttttggactcctatctttctaaaagttgcggttatg |
36441530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 40082211 - 40082267
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
40082211 |
aggcttaattgcacttttggacacctatcttttcaaaagttgcggttatgatcccct |
40082267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 382 - 434
Target Start/End: Complemental strand, 40082506 - 40082454
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
40082506 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatga |
40082454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 41281844 - 41281900
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
41281844 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
41281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 47943774 - 47943718
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
47943774 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
47943718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 52613647 - 52613587
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
52613647 |
aaataaaaaaaatgcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
52613587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 53190953 - 53191009
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| || |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53190953 |
aaaataatggattaattgcacttttggacccctatctttccaaaagttgcggttatg |
53191009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 53192426 - 53192378
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53192426 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
53192378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 53422092 - 53422144
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
53422092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53422144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 2118705 - 2118768
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2118705 |
aaaatgaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
2118768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 5577246 - 5577191
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
5577246 |
ggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
5577191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 32508232 - 32508177
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
32508232 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
32508177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 432
Target Start/End: Original strand, 41223509 - 41223560
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
41223509 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
41223560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 41282160 - 41282105
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41282160 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41282105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 42230030 - 42230081
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42230030 |
aaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
42230081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 45760546 - 45760491
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45760546 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45760491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 390 - 440
Target Start/End: Original strand, 3212158 - 3212208
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatgaacccct |
3212208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 431
Target Start/End: Original strand, 9153469 - 9153523
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
9153469 |
aaaacaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggtta |
9153523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 28097740 - 28097682
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
28097740 |
aaaggcttaattccacttttggacccctatcttttcaaaagttgcggttatggacccct |
28097682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 31869507 - 31869453
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
31869507 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
31869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 32205162 - 32205112
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
32205162 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
32205112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 36017077 - 36017019
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36017077 |
aaaggcttaatttcacttttagacccctatctttccaaaagttgcggttatgcacccct |
36017019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 47722139 - 47722197
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| ||||| ||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
47722139 |
ataaaacaaaggtttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
47722197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 49859528 - 49859574
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49859528 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatga |
49859574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 2239225 - 2239282
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2239225 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
2239282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 3384302 - 3384253
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
3384302 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
3384253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 8727915 - 8727968
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8727915 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8727968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 9079802 - 9079855
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9079802 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9079855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 9153788 - 9153735
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||| |||||| |
|
|
| T |
9153788 |
cttaattgcacttttggactcctatctttctaaaagttacggttatggacccct |
9153735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 21841726 - 21841775
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
21841726 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21841775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 27984446 - 27984397
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27984446 |
aggcttaattacacttttggacccctatctttccaaaagttgcggttatg |
27984397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 28097415 - 28097472
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
28097415 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
28097472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 33576405 - 33576462
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
33576405 |
aaggtttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
33576462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 381 - 438
Target Start/End: Complemental strand, 36373862 - 36373805
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
36373862 |
taaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
36373805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 45760230 - 45760287
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
45760230 |
aaggcttaattgcactttttgacctctatctttccaaaagttgcggttatggacccct |
45760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 50033556 - 50033499
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |||||||||||| |||||| |
|
|
| T |
50033556 |
aaggcttaattgcacttttggacccctatcttttcaaaggttgcggttatggacccct |
50033499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 52917633 - 52917584
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
52917633 |
aggcttaattgcacttttgggcccctatctttccaaaagttgcggttatg |
52917584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 331 - 384
Target Start/End: Complemental strand, 53413336 - 53413283
Alignment:
| Q |
331 |
cccaaccttgatgtaagcaatcacagataacaatagcaatacaaataaaataaa |
384 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
53413336 |
cccacccttgatgtaagcaatcacagataacaataacaatacaagtaaaataaa |
53413283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 53531804 - 53531861
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| |
|
|
| T |
53531804 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
53531861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 382 - 431
Target Start/End: Complemental strand, 54718164 - 54718115
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
54718164 |
aaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 257441 - 257493
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
257441 |
ttaattgtatttttggactcctatcttttcaaaagttgcggttatgaacccct |
257493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 2119027 - 2118979
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
2119027 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2118979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 17483871 - 17483823
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
17483871 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
17483823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 20982280 - 20982328
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
20982280 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
20982328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 32204847 - 32204903
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
32204847 |
aggcttaattgcacttttggacctctatctttccaaaagttgcgcttatggacccct |
32204903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 32458782 - 32458826
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32458782 |
ttaattgcatttttggactcctatctttccaaaagttgcggttat |
32458826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 438
Target Start/End: Original strand, 32507924 - 32507980
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| ||||||||||||||||| |||| |
|
|
| T |
32507924 |
aaaggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
32507980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 32593778 - 32593838
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
32593778 |
aaataaaataaaggtttaattgcacttttggacctctatcttttaaaaagttgcggttatg |
32593838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 38511971 - 38511923
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
38511971 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38511923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 44624540 - 44624484
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |
|
|
| T |
44624540 |
aggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
44624484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 45744213 - 45744157
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
45744213 |
aggcttaattgcacttttggatctctatctttccaaaagttgcggttatggacccct |
45744157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 47943458 - 47943514
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
47943458 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
47943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 49997655 - 49997703
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
49997655 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatg |
49997703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 49997970 - 49997914
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
49997970 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
49997914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 53191276 - 53191228
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53191276 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatg |
53191228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 787099 - 787154
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
787099 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
787154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 5576925 - 5576988
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
5576925 |
aaaatcaaggcttaattgtacttttggacccctatctttttaaaagttgcggttatgcacccct |
5576988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 383 - 438
Target Start/End: Complemental strand, 9793234 - 9793179
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||| ||||||||||| |||| |
|
|
| T |
9793234 |
aaggcttaattgcacttttggactcttatcttttcaaaaattgcggttatggaccc |
9793179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 17483561 - 17483616
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
17483561 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
17483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 26012984 - 26012933
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26012984 |
aaaggtttaattgcatttttggactcctatcttttcaaaagttgcggttatg |
26012933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 32459104 - 32459041
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
32459104 |
aaaaaaaaggcttaattgcatttttggatctctatctttccaaaagttgcggttatggacccct |
32459041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 43679015 - 43678960
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
43679015 |
ggcttaattgcacttttggacacctatattttcaaaagttgcggttatgaccccct |
43678960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 787416 - 787358
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
787416 |
aaagacttaattgcacttttggatccctatttttccaaaagttgcggttatggacccct |
787358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 374 - 432
Target Start/End: Complemental strand, 8315405 - 8315347
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||| |||||||||||||||||||||||| || ||||| ||| |||||||||||||||| |
|
|
| T |
8315405 |
aatataataaaggcttaattgcacttttgaacccctattttttcaaaagttgcggttat |
8315347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 387 - 433
Target Start/End: Complemental strand, 27719997 - 27719951
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
27719997 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 31869193 - 31869250
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| |||||||||||||||| |||||| |
|
|
| T |
31869193 |
aaaggcttaattgcacttttggac-cctatttttctaaaagttgcggttatggacccct |
31869250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 34942740 - 34942786
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34942740 |
ttaattgtacttttggactcctatcttttcaaaagttgcggttatga |
34942786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 44177597 - 44177543
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
44177597 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
44177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 44895638 - 44895704
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||| |||||||||| ||||| |||||| |
|
|
| T |
44895638 |
aataaaaaataggcttaattgcacttttggacccctatctttttaaaagttgcgattatggacccct |
44895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 439
Target Start/End: Original strand, 51213307 - 51213361
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
51213307 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccc |
51213361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 53764567 - 53764617
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
53764567 |
aaaagaaaggcttaattgcacttttggccccctatctttccaaaagttgcg |
53764617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 431
Target Start/End: Original strand, 54717165 - 54717211
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
54717165 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 432
Target Start/End: Original strand, 23086124 - 23086169
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23086124 |
cttaattgcatttttggactcctatctttccaaaagttgcagttat |
23086169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 27448813 - 27448862
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
27448813 |
aggcttaattgtacttttgaacccctatctttccaaaagttgcggttatg |
27448862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 33622177 - 33622124
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
33622177 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
33622124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 385 - 438
Target Start/End: Original strand, 38511659 - 38511712
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
38511659 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
38511712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 46934302 - 46934253
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
46934302 |
aggcttaattgcacttttggccccctatctttccaaaagttgcgattatg |
46934253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 380 - 433
Target Start/End: Original strand, 47423142 - 47423195
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
47423142 |
ataaaggtttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
47423195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 47722464 - 47722415
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47722464 |
aggcttaattgtatttttggactcctatcttttcaaaagttgcggttatg |
47722415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 2205540 - 2205592
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
2205540 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
2205592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 5154094 - 5154046
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
5154094 |
ggcttaattgcacttttggaccactatttttccaaaagttgcggttatg |
5154046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 7857980 - 7858036
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||| ||||| ||||| |
|
|
| T |
7857980 |
aggcttaattgtacttttggacccctatcttttcaaaagttgcggctatgaccccct |
7858036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 11961864 - 11961920
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||||||||||||| | |||||| |
|
|
| T |
11961864 |
aggcttaattgcacttttggacccctaacttttcaaaagttgcggttacggacccct |
11961920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 438
Target Start/End: Complemental strand, 24394004 - 24393952
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||| ||||||| |||| |
|
|
| T |
24394004 |
gcttaattgcacttttggattcctatcttttcaaaagttgtggttatggaccc |
24393952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 374 - 438
Target Start/End: Complemental strand, 24636665 - 24636601
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| | ||||||| ||||||||||||||||| |||| |
|
|
| T |
24636665 |
aataaaataaagacttaattgtacttttggatccttatcttttcaaaagttgcggttatggaccc |
24636601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 27984139 - 27984187
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
27984139 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatg |
27984187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29169042 - 29168986
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
29169042 |
aggcttaattgcacttttagacatctatcttttcaaaagttgcggttatggacccct |
29168986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 33252483 - 33252539
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||| ||||| |||||| |
|
|
| T |
33252483 |
aggcttaattgtacttttggacccctatctttctaaaagttgcgattatggacccct |
33252539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42465984 - 42465928
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||||||||||||||||| ||||| |
|
|
| T |
42465984 |
aggcttaattgcacttttgaacctcaatctttccaaaagttgcggttatgatcccct |
42465928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 386 - 430
Target Start/End: Original strand, 44701816 - 44701860
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
44701816 |
gcttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 51214473 - 51214417
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
51214473 |
aggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
51214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 423
Target Start/End: Original strand, 14904441 - 14904480
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14904441 |
aggcttaattgcacttttggacccctatctttccaaaagt |
14904480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 33933681 - 33933634
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
33933681 |
ggcttaattgcaattttggccccctatctttccaaaagttgcggttat |
33933634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 36441645 - 36441582
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||| ||||||||||||||||| | ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
36441645 |
aaaaaaaatgcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
36441582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 8728228 - 8728186
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8728228 |
aaaggtttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 424
Target Start/End: Complemental strand, 9080115 - 9080073
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9080115 |
aaaggtttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 21842026 - 21841976
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
21842026 |
aaggcttaattgcacttttagacctctatcttttcaaaagttgcggttatg |
21841976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 36567190 - 36567140
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| |||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
36567190 |
aaggcttaattgcatttttggcctcctaacttttcaaaagttgcggttatg |
36567140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 49859763 - 49859709
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
49859763 |
gcttaattgtacttttggacctctatcttttcaaaagttgcggttatgatcccct |
49859709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 7818936 - 7818981
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||| |
|
|
| T |
7818936 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatg |
7818981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 14133639 - 14133688
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||| ||| ||||||||||||||| ||||||||||| |
|
|
| T |
14133639 |
aggcttagttgcactttttgacccctatctttccaaaacttgcggttatg |
14133688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 14133934 - 14133886
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
14133934 |
aggcttaatt-cacttttggacccctatctttccaaaagttgtggttatg |
14133886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 21690183 - 21690134
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
21690183 |
aggcttaattgcacttttgcccccctatctttccaaaagttacggttatg |
21690134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 24636349 - 24636398
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
24636349 |
aggcttaattgtacttttggacccctatcttttcaaaagttgtggttatg |
24636398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 39905730 - 39905783
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
39905730 |
cttaattgcactttttgacctctatcttttcaaaagttgcggttatgaccccct |
39905783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 41223824 - 41223771
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
41223824 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
41223771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 41722297 - 41722244
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||| ||||||| |||| |
|
|
| T |
41722297 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgtggttatggaccc |
41722244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 374 - 427
Target Start/End: Complemental strand, 54716831 - 54716778
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| |||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
54716831 |
aataaaaaaaaggcttaattgcacttttggtcacctatctttttaaaagttgcg |
54716778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 372 - 440
Target Start/End: Complemental strand, 9588440 - 9588372
Alignment:
| Q |
372 |
caaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | | ||||||| |||||||||| ||||| |||||| |
|
|
| T |
9588440 |
caaataaaatttaggcttaattgcacttttgggcccttatcttttcaaaagttgcatttatggacccct |
9588372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 10439590 - 10439538
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
10439590 |
ttaattgcatttttggacccttatcttttcaaaagttgcggttatggacccct |
10439538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 14015456 - 14015408
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| || |||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
14015456 |
ggcttaagtgtacttttggacccctatcttttcaaaagttgcggttatg |
14015408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 37182313 - 37182257
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| || ||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37182313 |
aggcttaattgcggttatggacccctatcttttcaaaagttgcggttatggacccct |
37182257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 50033313 - 50033361
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
50033313 |
ggcttaattgcacttttagacctctatctttccaaaagttacggttatg |
50033361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 344 - 384
Target Start/End: Original strand, 53365512 - 53365552
Alignment:
| Q |
344 |
taagcaatcacagataacaatagcaatacaaataaaataaa |
384 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
53365512 |
taagcaatcacagataacaataacaatacaagtaaaataaa |
53365552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 7569130 - 7569173
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
7569130 |
aggcttaattgcacttttggcgtcctatcttttcaaaagttgcg |
7569173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 399 - 434
Target Start/End: Original strand, 14015178 - 14015213
Alignment:
| Q |
399 |
tttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14015178 |
tttggacccctatctttccaaaagttgcggttatga |
14015213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 433
Target Start/End: Original strand, 21689943 - 21689978
Alignment:
| Q |
398 |
ttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21689943 |
ttttggacccctatctttccaaaagttgcggttatg |
21689978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 24393687 - 24393746
Alignment:
| Q |
382 |
aaaggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
24393687 |
aaaggcttaattgcacttttggaccccctatctttttaaaagttgtggttatggacccct |
24393746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 46934038 - 46934081
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
46934038 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
46934081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 51842801 - 51842856
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||||||||||| |||||| |
|
|
| T |
51842801 |
ggcttaattgcacttttagatctctatcttttcaaaagttgcggttatggacccct |
51842856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 427
Target Start/End: Complemental strand, 5636733 - 5636679
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||| |||| | |||||||| |
|
|
| T |
5636733 |
aaataaaataaaggtttaattgcacttttgacctcctatgtttcaagaagttgcg |
5636679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 427
Target Start/End: Complemental strand, 14770743 - 14770689
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| ||| |||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
14770743 |
aaatataatcaaggtttaattgcacttttggccctctatctttccaaaagttgcg |
14770689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 433
Target Start/End: Complemental strand, 31577731 - 31577685
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
31577731 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatg |
31577685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 34943030 - 34942981
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| ||||||| |
|
|
| T |
34943030 |
aaggcttaattgcacttttgga-tcctatctttttaaaagttgtggttatg |
34942981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 51860333 - 51860386
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| | ||||||||||||||| |||| |
|
|
| T |
51860333 |
aggcttaattgcatttttggacccctatcttttc-aaagttgcggttatggaccc |
51860386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 53422392 - 53422342
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||| ||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
53422392 |
aaggtttaattacacttttagacccctatctttctaaaagttgcggttatg |
53422342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 415
Target Start/End: Original strand, 53568289 - 53568323
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatcttt |
415 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
53568289 |
taaaggcttaattgcacttttggcctcctatcttt |
53568323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 5153779 - 5153836
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| |||||||| ||||||| |||||||| |||||| |
|
|
| T |
5153779 |
aaggtttaattgcacttttggacctctatctttttaaaagttacggttatggacccct |
5153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 432
Target Start/End: Original strand, 9792919 - 9792968
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||| ||||||||||||||| || ||| ||||| |||||||||||||||| |
|
|
| T |
9792919 |
aaggtttaattgcacttttgaacccctttcttttcaaaagttgcggttat |
9792968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 22202793 - 22202748
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
22202793 |
ttaattgcacttttggatccctatcttttcaaaagttacggttatg |
22202748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 423
Target Start/End: Original strand, 39589006 - 39589047
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
39589006 |
aaaggctaaattgcatttttggacccctatctttccaaaagt |
39589047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 48160486 - 48160531
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
48160486 |
ttaattgcatatttggacccctatcttttcaaaagttgcggttatg |
48160531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 425
Target Start/End: Original strand, 51187717 - 51187758
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| ||||||||| |
|
|
| T |
51187717 |
aggcttaattgcacttttggcctcttatcttttcaaaagttg |
51187758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 425
Target Start/End: Original strand, 54716475 - 54716516
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
54716475 |
aggcttaattgcacttttggccccctatcttttcaaaagttg |
54716516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 10439285 - 10439341
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| |||||||| ||||||| |||||| |
|
|
| T |
10439285 |
aggcttaattgcacttttggacctctatttttttaaaagttgtggttatggacccct |
10439341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 424
Target Start/End: Complemental strand, 14004148 - 14004108
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
14004148 |
aggcttaattgcacttttggatccctatcttttcaaaagtt |
14004108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 27449268 - 27449224
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| |||||| |||| |
|
|
| T |
27449268 |
ttaattgcacttttgaactcctatcttttcaaaggttgcgtttat |
27449224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 423
Target Start/End: Original strand, 39708008 - 39708048
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39708008 |
aaggtttaattgcacttttcgacccctatctttccaaaagt |
39708048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 427
Target Start/End: Complemental strand, 40410189 - 40410145
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctt-tccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
40410189 |
aggcttaattgcacttttggccccctatcttgtccaaaagttgcg |
40410145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 59; Significance: 8e-25; HSPs: 179)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 35437538 - 35437472
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35437538 |
aataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 3235437 - 3235374
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
3235437 |
aaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3235374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 10312544 - 10312485
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10312544 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10312485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 34288045 - 34288103
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34288045 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
34288103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 21782597 - 21782658
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
21782597 |
aataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
21782658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 11900046 - 11900105
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11900046 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 18074131 - 18074080
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18074131 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
18074080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 378 - 440
Target Start/End: Complemental strand, 19194481 - 19194419
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
19194481 |
aaataaaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
19194419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 27432487 - 27432545
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27432487 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27432545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 34533211 - 34533269
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
34533211 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
34533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 36376057 - 36376115
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36376057 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 11900365 - 11900308
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11900365 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 26612336 - 26612397
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
26612336 |
aataaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
26612397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 46622552 - 46622609
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
46622552 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
46622609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 3925784 - 3925848
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3925784 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 5096787 - 5096843
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
5096787 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5096843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 7974705 - 7974649
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7974705 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7974649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 16537068 - 16537132
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16537068 |
taaaatattggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16537132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 16628594 - 16628530
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16628594 |
taaaatattggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16628530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 380 - 440
Target Start/End: Original strand, 23909890 - 23909950
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23909890 |
ataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23909950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 25982988 - 25983044
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
25982988 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25983044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 25987245 - 25987181
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
25987245 |
taaaaaaaaggattaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 39753871 - 39753927
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
39753871 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39753927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 42997055 - 42997111
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42997055 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42997111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 10318883 - 10318946
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10318883 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatgaacccct |
10318946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 16879554 - 16879503
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16879554 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16879503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 27512798 - 27512857
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
27512798 |
taaaggcttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
27512857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 34533530 - 34533471
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34533530 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34533471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 38053461 - 38053406
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38053461 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
38053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 32555617 - 32555559
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
32555617 |
aaaggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
32555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 35924207 - 35924149
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
35924207 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
35924149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 40436033 - 40436091
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40436033 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
40436091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 9035673 - 9035620
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
9035673 |
cttaattgcacttttggattcctatctttccaaaagttgcggttatggacccct |
9035620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 18852493 - 18852550
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
18852493 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18852550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 432
Target Start/End: Original strand, 19194158 - 19194207
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19194158 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
19194207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 35923894 - 35923947
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35923894 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35923947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 380 - 433
Target Start/End: Original strand, 43632336 - 43632389
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
43632336 |
ataaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatg |
43632389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 380 - 433
Target Start/End: Complemental strand, 48871406 - 48871353
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48871406 |
ataaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
48871353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 931022 - 930966
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
931022 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
930966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 9629330 - 9629274
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
9629330 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
9629274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 380 - 440
Target Start/End: Original strand, 18073811 - 18073871
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
18073811 |
ataatggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
18073871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 18295855 - 18295907
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
18295855 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
18295907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 18296165 - 18296109
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
18296165 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
18296109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 18852807 - 18852751
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
18852807 |
aggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
18852751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 19233632 - 19233584
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19233632 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
19233584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 21917564 - 21917508
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
21917564 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21917508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 25986924 - 25986980
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25986924 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25986980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 30140919 - 30140975
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
30140919 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
30140975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 433
Target Start/End: Complemental strand, 30401225 - 30401173
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
30401225 |
taaaggcttaattgcacttttggactcctatcttttcaaaagttgtggttatg |
30401173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 35121727 - 35121671
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
35121727 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35121671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 35437205 - 35437261
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35437205 |
aggcttaattgcacatttggacccctatctttccaaaagttgcggttatggacccct |
35437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 433
Target Start/End: Complemental strand, 36376379 - 36376327
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36376379 |
taaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
36376327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 37452363 - 37452307
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37452363 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37452307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 39976729 - 39976777
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39976729 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
39976777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 44214658 - 44214714
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
44214658 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
44214714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 3926071 - 3926016
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
3926071 |
ggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
3926016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 4061301 - 4061246
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4061301 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
4061246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 10385762 - 10385707
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||| |
|
|
| T |
10385762 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgattatgaccccct |
10385707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 26612656 - 26612601
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26612656 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26612601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 376 - 431
Target Start/End: Original strand, 30085612 - 30085667
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
30085612 |
taaaagaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 30699015 - 30699078
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
30699015 |
aaaattaaggcttaattgcacttttggatccctatctttccaaaagttgcagttatggacccct |
30699078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 38445719 - 38445664
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38445719 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38445664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 38882698 - 38882631
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatc-tttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||| ||||||||||||||||||||| |||||| |
|
|
| T |
38882698 |
aataaaaacaaggcttaattgcacttttggacccctatcttttccaaaagttgcggttatggacccct |
38882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 43408520 - 43408469
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
43408520 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
43408469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 44189406 - 44189453
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44189406 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
44189453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 7974386 - 7974444
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7974386 |
aaaggcttaattgcacttttgaacccctatttttccaaaagttgcggttatggacccct |
7974444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 18363609 - 18363559
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18363609 |
aaggcttaattgcacttttggacccctatctttgcaaaagttgcggttatg |
18363559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 19778568 - 19778518
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
19778568 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
19778518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 4060990 - 4061043
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4060990 |
cttaattgcacttttgaacccctatcttttcaaaagttgcggttatgaacccct |
4061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 10319206 - 10319153
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
10319206 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
10319153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 10356412 - 10356363
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
10356412 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatg |
10356363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 19233339 - 19233388
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19233339 |
aggcttaattgcacttttggaaccctatctttccaaaagttgcggttatg |
19233388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 375 - 432
Target Start/End: Complemental strand, 30141243 - 30141186
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||| || |||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
30141243 |
ataaattataggcttaattgcacttttggacccctatctttgcaaaagttgcggttat |
30141186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 30757218 - 30757279
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
30757218 |
aatataggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
30757279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 37047977 - 37047924
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37047977 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37047924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 38879464 - 38879415
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
38879464 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggctatg |
38879415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 227960 - 228012
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
227960 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
228012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 388214 - 388166
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
388214 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
388166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 3931804 - 3931752
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
3931804 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
3931752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 16879234 - 16879290
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16879234 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
16879290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 18363294 - 18363350
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
18363294 |
aggcttaattgcacttttggacccctatgtttccaaaagttgcgattatggacccct |
18363350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 18798033 - 18798085
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18798033 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
18798085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 438
Target Start/End: Original strand, 23740261 - 23740317
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
23740261 |
aaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
23740317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 23740579 - 23740523
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
23740579 |
aggcttaattgtacttttggacccctatctttcgaaaagttgcggttatggacccct |
23740523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 25983313 - 25983249
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| |||||||||||||||| |||||| |
|
|
| T |
25983313 |
taaaataaaggcttaattgcacttttgggcctctatctttttaaaagttgcggttatggacccct |
25983249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 438
Target Start/End: Complemental strand, 27513117 - 27513061
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||||||||||| |||| |
|
|
| T |
27513117 |
aaaggcttaattgcacttttggacccctatcttttcgaaagttgcggttatggaccc |
27513061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 30699337 - 30699289
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
30699337 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
30699289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 35121412 - 35121468
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
35121412 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
35121468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 35711968 - 35711916
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
35711968 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35711916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 37996016 - 37996072
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| |||||||||||| |||||| |
|
|
| T |
37996016 |
aggcttaattgcacttttggacccctatcttttcaaacgttgcggttatggacccct |
37996072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 38882369 - 38882425
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38882369 |
aggcttaattgcatttttgtacccctatcttttcaaaagttgcggttatgaacccct |
38882425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 45231830 - 45231778
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45231778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 228279 - 228216
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||| |||||||||||||| || |||||| |
|
|
| T |
228279 |
aaaaaaaaggtttaattgcacttttggacccctatcttttcaaaagttgcggttttggacccct |
228216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 497108 - 497167
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||| |||||||||| |||||| |||||| |
|
|
| T |
497108 |
taaaggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
497167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 930708 - 930763
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
930708 |
ggcttaattacacttttggacccctatcttttcaaaagttgcggttatggacccct |
930763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 10350798 - 10350861
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
10350798 |
aaaaaaaaggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
10350861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 17757762 - 17757825
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
17757762 |
aaaagaaaggcttaattgcacttttagacccctatctttttaaaagttgcggttatggacccct |
17757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 23910168 - 23910113
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
23910168 |
ggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
23910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 24775938 - 24775883
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
24775938 |
ggcttaattgcacttttggacccctatctctccaaaagttgtggttatggacccct |
24775883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 431
Target Start/End: Complemental strand, 30086617 - 30086570
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
30086617 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 34404443 - 34404498
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
34404443 |
ggcttaattgcacttttagacccctatctttccaaaaattgcggttatggacccct |
34404498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 34404752 - 34404693
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| || | ||||||||||||||||||||||||| |||||| |
|
|
| T |
34404752 |
taaaggcttaagtgcacttttgaacccttatctttccaaaagttgcggttatggacccct |
34404693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 5097097 - 5097043
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
5097097 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
5097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 431
Target Start/End: Original strand, 10715838 - 10715884
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
10715838 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 20387550 - 20387608
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||||| |||||| |||||| |
|
|
| T |
20387550 |
aaagacttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20387608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 20392024 - 20392082
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||||| | |||||||||||||||||| |||||| |||||| |
|
|
| T |
20392024 |
aaagacttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20392082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 21917083 - 21917141
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
21917083 |
aaaggcttaattgcacttttggatccctattttttcaaaagttgcggttatggacccct |
21917141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 35711656 - 35711713
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||||||||||||||| |||||| |
|
|
| T |
35711656 |
aaaggcttaattgcacttttggacccctatcttttc-aaagttgcggttatggacccct |
35711713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 9629011 - 9629060
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
9629011 |
aggcttaattacacttttggactcctatctttttaaaagttgcggttatg |
9629060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 11275190 - 11275235
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11275190 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatg |
11275235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 11578370 - 11578321
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
11578370 |
aggcttaattgtacttttggacccctatctttccaaaggttgcggttatg |
11578321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 19778277 - 19778322
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
19778277 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 20387865 - 20387808
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| ||||||| |||||| |
|
|
| T |
20387865 |
aaggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20387808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 20392339 - 20392282
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||| ||||||| |||||| |
|
|
| T |
20392339 |
aaggcttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 424
Target Start/End: Complemental strand, 25683990 - 25683949
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25683990 |
aaggcttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 47731700 - 47731757
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| ||||||||||| |||||| |
|
|
| T |
47731700 |
aaggcttaattgcacttttggacccctatcttttaaaaaattgcggttatggacccct |
47731757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 18798320 - 18798276
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18798320 |
ttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 30028386 - 30028442
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||| |||||||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
30028386 |
aaaaaaaagacttaattgcactttaggacccctatctttctaaaagttgcggttatg |
30028442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 37047668 - 37047720
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
37047668 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
37047720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 38879160 - 38879216
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
38879160 |
aggcttaattgtacttttggacctctatcttttcaaaagttgcggttatggacccct |
38879216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 392 - 440
Target Start/End: Complemental strand, 39754180 - 39754132
Alignment:
| Q |
392 |
ttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
39754180 |
ttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39754132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42751256 - 42751200
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||| ||||||||||||||||||||||| |
|
|
| T |
42751256 |
aggcttaattgcacttttggacccttatttttttaaaagttgcggttatgaacccct |
42751200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 43408224 - 43408272
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43408224 |
ggcttaatttcacttttggacctctatctttccaaaagttgcggttatg |
43408272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 45231522 - 45231570
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
45231522 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatg |
45231570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 46622867 - 46622811
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||| |||||||||||| |||||| |
|
|
| T |
46622867 |
aggcttaattgcacttttcaacccctatctttccaaaggttgcggttatggacccct |
46622811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 3931646 - 3931701
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||| |||||||| ||||| |
|
|
| T |
3931646 |
ggcttaattgcacttttggacctctatcttttcaaaagttggggttatgaccccct |
3931701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 10351119 - 10351064
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| || |||||| |||||||| |||||||| |||||| |
|
|
| T |
10351119 |
ggcttaattgcacttttggaccccaatcttttcaaaagttacggttatggacccct |
10351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 380 - 427
Target Start/End: Complemental strand, 21202920 - 21202873
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21202920 |
ataaaggtttaattgcacttttggccccctatctttccaaaagttgcg |
21202873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 34288364 - 34288309
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||||||| |||||| |
|
|
| T |
34288364 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
34288309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 42997365 - 42997318
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
42997365 |
ggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 387 - 438
Target Start/End: Complemental strand, 47732014 - 47731963
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||||||||||| |||| |
|
|
| T |
47732014 |
cttaattgcacttttggacccttatcttttcaaaagttgcggttatggaccc |
47731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 9035356 - 9035406
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
9035356 |
aaggcttaattgcaattttggacccctatctttttaaaagttgcggttatg |
9035406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 21782915 - 21782861
Alignment:
| Q |
387 |
cttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||| |||||| |
|
|
| T |
21782915 |
cttaattgcacttttggaccccctatctttccaaaagttgtggttatggacccct |
21782861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 421
Target Start/End: Original strand, 38053144 - 38053182
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaa |
421 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38053144 |
aaggcttaattgcacttttggacccctatctttccaaaa |
38053182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 381 - 427
Target Start/End: Original strand, 40139525 - 40139571
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
40139525 |
taaaggcttaattgcacttttgggcccctatctttctaaaagttgcg |
40139571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 44189699 - 44189649
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
44189699 |
aaggtttaattgcacttctggacccctatcttttcaaaagttgcggttatg |
44189649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 11578045 - 11578110
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||| || ||||||| |||||||||| |||||| ||| |||||||||||||||| |||||| |
|
|
| T |
11578045 |
ataaattaatggtttaattgtacttttggacccctatcattcaaaaagttgcggttatggacccct |
11578110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 16537391 - 16537342
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||| ||||||| |
|
|
| T |
16537391 |
aggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatg |
16537342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 16628271 - 16628320
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||| |||||||| ||||||| |
|
|
| T |
16628271 |
aggcttaattgcacttttggacccctgtctttcgaaaagttgtggttatg |
16628320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 21954391 - 21954346
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
21954391 |
aaaggcttaattgcacttttgaccccctatctttccaaaagttgcg |
21954346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 24236423 - 24236366
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||||| || | |||||||| |||||||||||||||| |||||| |
|
|
| T |
24236423 |
aaggcttaattgcatttttgcacccgtatctttctaaaagttgcggttatggacccct |
24236366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 26872673 - 26872624
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||||| ||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
26872673 |
ggcttaattccacttttggacccttatcttttcaaaagttgcggttatga |
26872624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 30028693 - 30028648
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||| ||||||| |
|
|
| T |
30028693 |
ttaattgcacttttggactcttatcttttcaaaagttgtggttatg |
30028648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 37996322 - 37996269
Alignment:
| Q |
388 |
ttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
37996322 |
ttaattgcatttttggatcccctatctttccaaaagttgcggttatggacccct |
37996269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 379 - 440
Target Start/End: Complemental strand, 44215046 - 44214986
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||| |||||||||||| ||||||| | ||||||||||||||| |||||| |
|
|
| T |
44215046 |
aataaaggtttaattgtacttttggactcttatcttt-ctaaagttgcggttatggacccct |
44214986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 10385469 - 10385517
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||| | |||||||| |||||||||||||||| |
|
|
| T |
10385469 |
ggcttaattgcacttttagacccttatctttctaaaagttgcggttatg |
10385517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 11275478 - 11275430
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| ||| ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11275478 |
ggcttaattacacctttggacccctatcttttcaaaagttgcggttatg |
11275430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 427
Target Start/End: Complemental strand, 18201703 - 18201655
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||| ||||||||||| |
|
|
| T |
18201703 |
aataaaggcttaattgcacttttggccccctgtcttttcaaaagttgcg |
18201655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 25036024 - 25036080
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||| |||||||||||||||| ||| ||||| ||| ||||||||||||||||| |
|
|
| T |
25036024 |
aaaaaaaaagcttaattgcactttttgacccctatattttcaaaagttgcggttatg |
25036080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 30757534 - 30757482
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||||| |||||| |
|
|
| T |
30757534 |
ttaattgcacttttggacccctatttttttaaaagttgcggttatggacccct |
30757482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 425
Target Start/End: Complemental strand, 31530432 - 31530392
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
31530432 |
ggcttaattgcacttttggccccctatctttccaaaagttg |
31530392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 38445407 - 38445459
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
38445407 |
ttaattgcacttttggatccctatctttcaaaaagttgtggttatggacccct |
38445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 40139876 - 40139832
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
40139876 |
aaggcttaattgcacttttggccccctatctttctaaaagttgcg |
40139832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 11742971 - 11742916
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
11742971 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcgattttgatcccct |
11742916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 431
Target Start/End: Original strand, 26872384 - 26872427
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
26872384 |
ttaattgcacttttgaacccctatatttccaaaagttgcggtta |
26872427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 37452048 - 37452099
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| || | ||||||| ||||||||||||||||| |
|
|
| T |
37452048 |
aaaggcttaattgcacttttagatccatatcttttcaaaagttgcggttatg |
37452099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 425
Target Start/End: Complemental strand, 39142506 - 39142463
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
39142506 |
aaaggcttaattgcacttttggtcccctatcttttcaaaagttg |
39142463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 40436288 - 40436241
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
40436288 |
gcttaattgcatttttggacccttatctttccaaaagttgcgattatg |
40436241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Complemental strand, 40790984 - 40790942
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
40790984 |
aggcttaattgcacttttggcc-cctatctttccaaaagttgcg |
40790942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 424
Target Start/End: Complemental strand, 47351141 - 47351102
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
47351141 |
ggcttaattgcacttttagcctcctatctttccaaaagtt |
47351102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 1449982 - 1450024
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
1449982 |
aggcttaattgcacttttggccacctatctttcaaaaagttgc |
1450024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 426
Target Start/End: Complemental strand, 7380699 - 7380653
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
7380699 |
ataaaggtttaattgtacttttggcctcctatcttttcaaaagttgc |
7380653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Complemental strand, 8409385 - 8409343
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
8409385 |
ggcttaattgcacttttggcctcctatctttttaaaagttgcg |
8409343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 427
Target Start/End: Original strand, 18201350 - 18201396
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
18201350 |
taaaggcttaattgcacttttggcccactatctttctaaaagttgcg |
18201396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 436
Target Start/End: Complemental strand, 25036345 - 25036295
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaac |
436 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| |||||||||| |
|
|
| T |
25036345 |
gcttaattgcacttttggatccctatctttttaaaagttgtggttatgaac |
25036295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 45863284 - 45863243
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
45863284 |
aggcttaattgcacttttggcct-ctatctttccaaaagttgc |
45863243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 5181746 - 5181689
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||| ||||| |||| |||||| |||||| |
|
|
| T |
5181746 |
aaggtttaattgcacttttagacccctatcttttcaaaaattgcagttatggacccct |
5181689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 7195772 - 7195723
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7195772 |
aggcttaattccacttttggacctatatttttccaaaagttgcggttatg |
7195723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 10356116 - 10356165
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
10356116 |
aggcttaattgcatttttagatctctatctttccaaaagttgcggttatg |
10356165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 10986003 - 10986048
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
10986003 |
ttaattgcacttttagacctctatcttttcaaaagttgcggttatg |
10986048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 17167852 - 17167896
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
17167852 |
aaaggcttaattgcacttttgg-cccctatcttttcaaaagttgcg |
17167896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 440
Target Start/End: Original strand, 24236136 - 24236169
Alignment:
| Q |
407 |
cctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
24236136 |
cctatctttccaaaagttgcggttatggacccct |
24236169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 49081643 - 49081598
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
49081643 |
ttaattgcacttttagatccctatcttttcaaaagttgcggttatg |
49081598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 427
Target Start/End: Original strand, 11742704 - 11742752
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| ||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
11742704 |
aataaagacttaattgcacttttggccccctatctttttaaaagttgcg |
11742752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 29163098 - 29163142
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | | ||||||||| ||||||||||| |
|
|
| T |
29163098 |
aaggcttaattgcactttttgccccctatcttttcaaaagttgcg |
29163142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 29163364 - 29163320
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||| |
|
|
| T |
29163364 |
aaggcttaattgcacttttgaccttctatcttttcaaaagttgcg |
29163320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 36203993 - 36204036
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||| |
|
|
| T |
36203993 |
aaaggcttaattgcactttt-gacccctatctttctaaaagttgc |
36204036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 424
Target Start/End: Original strand, 45259952 - 45259992
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
45259952 |
aggcttaattgcacttttggtttcctatcttttcaaaagtt |
45259992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 427
Target Start/End: Complemental strand, 45480140 - 45480100
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
45480140 |
cttaattgcacttttggccccctatcttttcaaaagttgcg |
45480100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 1e-23; HSPs: 171)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 16521145 - 16521209
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16521145 |
taaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16521209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 3223608 - 3223549
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3223608 |
aataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
3223549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 16666897 - 16666838
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16666897 |
aataaaataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16666838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 4125435 - 4125499
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4125435 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4125499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 35306709 - 35306765
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35306709 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
35306765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 16079493 - 16079443
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16079493 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
16079443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 28620028 - 28620094
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28620028 |
aataaaattaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28620094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 40297654 - 40297720
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
40297654 |
aataaaatgtaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40297720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 2710338 - 2710395
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
2710338 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2710395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 5088387 - 5088330
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
5088387 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5088330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 40687656 - 40687721
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40687656 |
ataaaattaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40687721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 40768203 - 40768146
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
40768203 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40768146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 7219811 - 7219755
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
7219811 |
aggcttaattgcacttttggactcttatctttccaaaagttgcggttatggacccct |
7219755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 12049110 - 12049174
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12049110 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
12049174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 15526703 - 15526759
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
15526703 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15526759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 20974451 - 20974515
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20974451 |
taaaaaaaagacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20974515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 21583636 - 21583588
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21583636 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
21583588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 27264108 - 27264164
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27264108 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 28394932 - 28394988
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
28394932 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29401403 - 29401347
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
29401403 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29401347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 31456175 - 31456119
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31456175 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
31456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 378 - 438
Target Start/End: Complemental strand, 34082421 - 34082361
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
34082421 |
aaataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgcaccc |
34082361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 34606692 - 34606628
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34606692 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34606628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 35307024 - 35306960
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
35307024 |
taaattaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35306960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 223207 - 223152
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
223207 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 2546363 - 2546426
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
2546363 |
aaaaaaaaagcttaattgcacttttggacccctatctttccaaaagttacggttatgaacccct |
2546426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 8986610 - 8986665
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
8986610 |
ggcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
8986665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 23263137 - 23263200
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23263137 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23263200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 42947398 - 42947449
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42947398 |
aaaggcttaattgcacttttggactcctatctttctaaaagttgcggttatg |
42947449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 13170204 - 13170138
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| | |||||||| |||||||||||||||| |||||| |
|
|
| T |
13170204 |
aataaattaaaggcttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
13170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 30894124 - 30894178
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
30894124 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
30894178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 31172876 - 31172822
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
31172876 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
31172822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 41880349 - 41880295
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
41880349 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41880295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 2710652 - 2710595
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2710652 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2710595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 9071967 - 9072016
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9071967 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Complemental strand, 9072271 - 9072214
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
9072271 |
taaaaaaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatg |
9072214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 13356551 - 13356612
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
13356551 |
aatataggcttgattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13356612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 28395244 - 28395191
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
28395244 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28395191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Complemental strand, 41032508 - 41032451
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41032508 |
taaattaaaggcttaattgcacttttggatccctatctttccaaaagttgcggttatg |
41032451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 43586100 - 43586051
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43586100 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43586051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 3020908 - 3020852
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3020908 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3020852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 4125758 - 4125702
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
4125758 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
4125702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 5088073 - 5088129
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
5088073 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
5088129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 11480035 - 11480091
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
11480035 |
aggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
11480091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 18266351 - 18266407
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
18266351 |
aggcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
18266407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 22052438 - 22052494
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22052438 |
aggcttaattgcacttttggccccctatctttccaaaagttgcggttatggacccct |
22052494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 22052753 - 22052697
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22052753 |
aggcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
22052697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 23103922 - 23103978
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
23103922 |
aggcttaattacacttttggacccctatctttccaaaagttgcggttatggacccct |
23103978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 27264415 - 27264363
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27264415 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 29183136 - 29183188
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
29183136 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29183188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 34734387 - 34734331
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34734387 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34734331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 381 - 433
Target Start/End: Complemental strand, 39529082 - 39529030
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39529082 |
taaaggcttaattacacttttggacccctatctttccaaaagttgcggttatg |
39529030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 43585793 - 43585853
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||| ||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
43585793 |
aaataaattaaaggcataattgcacttttggacccctatctttctaaaagttgcggttatg |
43585853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 8339959 - 8340014
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8339959 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8340014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 14647688 - 14647751
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
14647688 |
aaaaaaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
14647751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 15738394 - 15738331
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
15738394 |
aaaaaaaaggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
15738331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 388 - 439
Target Start/End: Complemental strand, 25566852 - 25566801
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
25566852 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
25566801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 26036532 - 26036481
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26036532 |
aaaggctaaattgcacttttggacccctatctttccaaaagttgcggttatg |
26036481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 26323688 - 26323633
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26323688 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 28251395 - 28251446
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28251395 |
aaagtcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
28251446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 28736761 - 28736698
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
28736761 |
aaaaaaaaggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
28736698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 34169101 - 34169046
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34169101 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34169046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 42739900 - 42739845
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
42739900 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatgaacccct |
42739845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 3020583 - 3020649
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| || |||||||||||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
3020583 |
aataaactataggcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
3020649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 7623844 - 7623778
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||| ||||||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
7623844 |
aataaaaaaaaggtttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
7623778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 29559772 - 29559822
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
29559772 |
aaggcttaattgcacttttggattcctatcttttcaaaagttgcggttatg |
29559822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 41140429 - 41140379
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
41140429 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
41140379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 5891790 - 5891745
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5891790 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
5891745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 10029387 - 10029330
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| || |||||||||| |||||||||||||||| |||||| |
|
|
| T |
10029387 |
aaggcttaattgcacttttgaacccctatctttcgaaaagttgcggttatggacccct |
10029330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 13765576 - 13765519
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| ||||||||||| |||||| |
|
|
| T |
13765576 |
aaggcttaattgcacttttggacccctatctttcaaaaaattgcggttatggacccct |
13765519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 26151792 - 26151849
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
26151792 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26151849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 432
Target Start/End: Complemental strand, 28251693 - 28251644
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28251693 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 29391328 - 29391279
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
29391328 |
aggcttaattgcacttttagactcttatctttccaaaagttgcggttatg |
29391279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 32556059 - 32556010
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
32556059 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatg |
32556010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 40767890 - 40767943
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40767890 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40767943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 390 - 438
Target Start/End: Original strand, 1050041 - 1050089
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
1050089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 1055682 - 1055634
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
1055682 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
1055634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 7623525 - 7623576
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7623525 |
ttaattgcacttttggac-cctatctttccaaaagttgcggttatggacccct |
7623576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 9560148 - 9560092
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9560148 |
aggcttaattgcatttttggacccctatctttctaaaagttgcggttatgaccccct |
9560092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 12049431 - 12049383
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
12049431 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttat |
12049383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 13356863 - 13356807
Alignment:
| Q |
385 |
ggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
13356863 |
ggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
13356807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 13765258 - 13765314
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
13765258 |
aggcttaattgcacttttcgacccctatcttttcaaaagttgcggttatggacccct |
13765314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 13960691 - 13960743
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
13960743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 16666072 - 16666128
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16666072 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
16666128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 19849555 - 19849607
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
19849555 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
19849607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 19849857 - 19849801
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
19849857 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggtcatggacccct |
19849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 25631085 - 25631141
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
25631085 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
25631141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 28703962 - 28703914
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28703962 |
ggctgaattgcacttttggacccctatctttccaaaagttgcggttatg |
28703914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 28736443 - 28736495
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
28736443 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggacccct |
28736495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 33825603 - 33825655
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
33825603 |
ttaattgcacgtttggacccctatctttccaaaagttgcggttatggacccct |
33825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 35055776 - 35055832
Alignment:
| Q |
385 |
ggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35055776 |
ggcttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
35055832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 40297976 - 40297924
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
40297976 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
40297924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 40687983 - 40687927
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||| |
|
|
| T |
40687983 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
40687927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 20465500 - 20465551
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
20465500 |
aaaggcttaattacacttttggacccctatctttccaaaagttgcagttatg |
20465551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 23263458 - 23263403
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
23263458 |
ggcttaattgcacttttggacctctatctttccaacagttgcggttatggacccct |
23263403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 390 - 437
Target Start/End: Original strand, 23499971 - 23500018
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggttatgaacc |
437 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
23499971 |
aattgcacttttggacccctatcttttcaaaagttgcggttatgaacc |
23500018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 23502441 - 23502386
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||| |||||| |
|
|
| T |
23502441 |
ggcttaattgcacttttggacccctatctttccaaaagttgctattatggacccct |
23502386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 31455882 - 31455937
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
31455882 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
31455937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 7219497 - 7219551
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| ||||||||||||||||| |||| |
|
|
| T |
7219497 |
aggcttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
7219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 16597038 - 16597096
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
16597038 |
aaaggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
16597096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 16597355 - 16597305
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
16597355 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
16597305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 21583321 - 21583371
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
21583321 |
aaggcttaattgcactttgggacctctatctttccaaaagttgcggttatg |
21583371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 22773897 - 22773843
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
22773897 |
gcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
22773843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 23695523 - 23695581
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| | ||| ||||| ||||||||||||||| |||||| |
|
|
| T |
23695523 |
aaaggcttaattgcacttttggacccatatttttcccaaagttgcggttatggacccct |
23695581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 438
Target Start/End: Original strand, 34168790 - 34168840
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
34168790 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggaccc |
34168840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 1055374 - 1055419
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
1055374 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
1055419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 3728283 - 3728332
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3728283 |
aggcttaattgtacttttggacctctatctttccaaaagttgcggttatg |
3728332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 3738391 - 3738436
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3738391 |
ttaattgcacttttggactcctattttttcaaaagttgcggttatg |
3738436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 439
Target Start/End: Complemental strand, 8340276 - 8340219
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
8340276 |
aaaggcttaattccacttttggacccctatcttttcaaaagttgcgcttatggacccc |
8340219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 376 - 433
Target Start/End: Complemental strand, 16860127 - 16860071
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
16860127 |
taaaataaag-cttaattgcacttttggacccctatttttctaaaagttgcggttatg |
16860071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 23104222 - 23104165
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatcttt-ccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||||||| |||||| |
|
|
| T |
23104222 |
aggcttaattgcacttttggacccttatcttttccaaaagttgcggttatggacccct |
23104165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 4096455 - 4096507
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||| ||||| |||||| |
|
|
| T |
4096455 |
ttaattgcacttttggacccctatctttctaaaagttgcgtttatggacccct |
4096507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 8755016 - 8755068
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
8755016 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
8755068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 15738074 - 15738122
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
15738074 |
ggcttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
15738122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20974723 - 20974667
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
20974723 |
aggcttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
20974667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 22925698 - 22925746
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
22925698 |
aggcttaattgcacttttgaacctctatctttccaaaagttgcggttat |
22925746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 26152106 - 26152050
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||| ||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
26152106 |
aggcttaattgtacttttagacccatatctttccaaaagttgcggttatggacccct |
26152050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 34082102 - 34082154
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34082102 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
34082154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 35678095 - 35678147
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
35678095 |
ttaattgcatttttggacccctatctttccaaaagttgcgattatggacccct |
35678147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 382 - 430
Target Start/End: Complemental strand, 37333849 - 37333801
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
37333849 |
aaaggcttaattgcacttttggacccttatctttctaaaagttgcggtt |
37333801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 4096767 - 4096716
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
4096767 |
aaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatg |
4096716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 10029071 - 10029122
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10029071 |
aaaggcttaattacttttttggacccctatctttccaaaagttgcggttatg |
10029122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 26323367 - 26323430
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||| |||| ||||||||| |||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
26323367 |
aaaaaaaagacttatttgcactttgggacccctatctttccaaaagttggggttatggacccct |
26323430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 387 - 438
Target Start/End: Original strand, 29401092 - 29401143
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||| |||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
29401092 |
cttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
29401143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 39528766 - 39528821
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||||||| |||||| |
|
|
| T |
39528766 |
ggcttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
39528821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 42739523 - 42739582
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
42739523 |
taaaggcttaattgtacttttgaacccctatcttttcaaaagttgtggttatggacccct |
42739582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 931846 - 931900
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
931846 |
aggcttaattgtacttttggatccctatcttttcaaaagttgcggttatggaccc |
931900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 2546687 - 2546637
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||| |||||| |
|
|
| T |
2546687 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcagttatg |
2546637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 381 - 423
Target Start/End: Complemental strand, 15221531 - 15221489
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
15221531 |
taaaggcttaattgcacttttggacccatatctttccaaaagt |
15221489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 30894432 - 30894374
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
30894432 |
aaaggcttaattgcatttttggatccctatcttttcaaaagttgtggttatggacccct |
30894374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 430
Target Start/End: Original strand, 34606372 - 34606418
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34606372 |
aggcttaattgcacttttaaacccctatctttccaaaagttgcggtt |
34606418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 41138553 - 41138603
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||||| | | |||||||||| |||||||||| |
|
|
| T |
41138553 |
aaaataaaggcttaattgcacttttagccccctatctttctaaaagttgcg |
41138603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 39282 - 39233
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| ||||||| |
|
|
| T |
39282 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcagttatga |
39233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 3223435 - 3223484
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | ||||| ||||||||||| |
|
|
| T |
3223435 |
aggcttaattgcacttttggacccctatctattcaaaaattgcggttatg |
3223484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 13961004 - 13960955
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
13961004 |
aggcttaattgtacttttggacctctatcttttcaaaagttgcggttatg |
13960955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 16329890 - 16329837
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
16329890 |
cttaattgcacttttggatccctatcttttcaaaagttgtggttatggacccct |
16329837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 21347742 - 21347697
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatg |
21347697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 26036234 - 26036283
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||| ||||||| |
|
|
| T |
26036234 |
aggcttaattgcacttttggacccatatcttttcaaaagttgtggttatg |
26036283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 33204261 - 33204197
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||| ||||||||||||||||| |||||| ||| |||||||| |||||||| |||||| |
|
|
| T |
33204261 |
ataaaattaaggtttaattgcacttttgga-tcctattttttcaaaagttacggttatggacccct |
33204197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 426
Target Start/End: Complemental strand, 37060211 - 37060170
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
37060211 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
37060170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 38981 - 39037
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| ||| ||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
38981 |
aaaatataggtttaattgcacttttggatccatatcttttcaaaagttgcggttatg |
39037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 425
Target Start/End: Complemental strand, 4146451 - 4146411
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
4146451 |
ggcttaattgcacttttggccccctatctttccaaaagttg |
4146411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 8755323 - 8755271
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||| ||| ||||||||| ||||||| |||||| |
|
|
| T |
8755323 |
ttaattgcacttttggacccctattttttcaaaagttgtggttatggacccct |
8755271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 8986927 - 8986868
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgc-ggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| | |||||||| ||||||| |||||| |
|
|
| T |
8986927 |
taaaggcttaattgcacttttggacccctatcttttc-aaagttgcgggttatggacccct |
8986868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 16329585 - 16329636
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
16329585 |
ttaattgcaattttggactc-tatcttttcaaaagttgcggttatggacccct |
16329636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 22627297 - 22627241
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |||||||| || |||||| |
|
|
| T |
22627297 |
aggcttaattgcacttttggatccctatcttttcaaaatttgcggttctggacccct |
22627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 28388302 - 28388238
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| | |||||| ||||||||||||||| ||| ||||||| |||||| |
|
|
| T |
28388302 |
taaattaaaggcttaattgcgcaattggacccctatctttccaaaaattgaggttatggacccct |
28388238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 32555764 - 32555812
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32555764 |
ggcttaattgcatttttggacccctatctttttaaaagttgcggttatg |
32555812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 33203941 - 33203985
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
33203941 |
ttaattgcaattttggacccctatcttttcaaaagttgcggttat |
33203985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 35678404 - 35678348
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||| |||||| |||||||||||||||| |
|
|
| T |
35678404 |
aaaaaaaagacttaattgcaattttggactcccatctttttaaaagttgcggttatg |
35678348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 42779166 - 42779222
Alignment:
| Q |
385 |
ggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||||||||| |||||| |
|
|
| T |
42779166 |
ggcttaattgcacttttggagcccctatctttttaaaagttgcggttatggacccct |
42779222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 3728576 - 3728529
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
3728576 |
gcttaattgcacttttggatctctatctttccaaaagttacggttatg |
3728529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 427
Target Start/End: Complemental strand, 8006323 - 8006284
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
8006323 |
ttaattgcacttttggcctcctatcttttcaaaagttgcg |
8006284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 426
Target Start/End: Complemental strand, 14514999 - 14514956
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
14514999 |
aaggtttaattgcacttttggccccctatctttccaaaagttgc |
14514956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 438
Target Start/End: Complemental strand, 15526984 - 15526929
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||| | |||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
15526984 |
aaggcttaattggatttttggacctatatctttccaaaagttgcggttatggaccc |
15526929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 34734063 - 34734122
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| |||||| ||||||||||||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
34734063 |
aataaattaaaggtttaattgcacttttggatctctatttttccaaaaattgcggttatg |
34734122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 431
Target Start/End: Original strand, 38465972 - 38466015
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
38465972 |
ttaattgcatttttggacccctatctttctaaaagttgcggtta |
38466015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 6815500 - 6815542
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
6815500 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
6815542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 16859956 - 16860006
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
16859956 |
aaggtttaattgcacttttggacccctatctttttaaaagttgtggttatg |
16860006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 17235319 - 17235277
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
17235319 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgc |
17235277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 379 - 425
Target Start/End: Original strand, 22626979 - 22627025
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||| ||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22626979 |
aatataggtttaattgcacttttggacctctatctttccaaaagttg |
22627025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 25631397 - 25631339
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||| |||||||||||||||| |||||| |
|
|
| T |
25631397 |
aaaggtttaattgcacttttggatctctatttttctaaaagttgcggttatggacccct |
25631339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 432
Target Start/End: Complemental strand, 29560092 - 29560042
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||| ||||||||||||||| |
|
|
| T |
29560092 |
aaaggcttaattgcatttatggacccctatctttttaaaagttgcggttat |
29560042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 12610241 - 12610286
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
12610241 |
aaaggcttaattgcacttttggccccctatctttttaaaagttgcg |
12610286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 425
Target Start/End: Original strand, 15204002 - 15204043
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
15204002 |
aggcttaattgcacttttggccacctatctttctaaaagttg |
15204043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 22773582 - 22773631
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| | |||||||||| |||||||| | |||||| |
|
|
| T |
22773582 |
aggcttaattgcacttttgaattcctatcttttcaaaagttacagttatg |
22773631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 416
Target Start/End: Complemental strand, 11709453 - 11709421
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttc |
416 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
11709453 |
aggcttaattgcacttttggacccctatctttc |
11709421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 17235134 - 17235178
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||| |||||||| | ||||||||| ||||||||||| |
|
|
| T |
17235134 |
aaggcttaattgtacttttggccccctatcttttcaaaagttgcg |
17235178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 389 - 440
Target Start/End: Original strand, 28387984 - 28388036
Alignment:
| Q |
389 |
taattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |||| |||||| |
|
|
| T |
28387984 |
taattgcacttttggaccccctatctttccaaaagttgcgtgtatggacccct |
28388036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 41032210 - 41032254
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
41032210 |
ttaattgaacttttggattcctatctttttaaaagttgcggttat |
41032254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 42779478 - 42779426
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||| |||||||||||||| ||| ||||||| |||||| |
|
|
| T |
42779478 |
ttaatcgcacttttggacctctatctttccaaaaattgtggttatggacccct |
42779426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 56; Significance: 5e-23; HSPs: 136)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 21843493 - 21843438
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21843493 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
21843438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 7464263 - 7464197
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
7464263 |
aataaaaagaaggcttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
7464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 19256912 - 19256847
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
19256912 |
ataaaaaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19256847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 3263341 - 3263281
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
3263341 |
aaataaaataaaggcttacttgcacttttggacccctatctttctaaaagttgcggttatg |
3263281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 1466810 - 1466865
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1466810 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 23000833 - 23000774
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23000833 |
aataaaaataaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23000774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 36987726 - 36987671
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36987726 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 24205291 - 24205349
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
24205291 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24205349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 25888215 - 25888149
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |
|
|
| T |
25888215 |
aataaagtaaaggcttaattgcacttttggacccctatctttacaaaagttacggttatggacccct |
25888149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 30219030 - 30218964
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30219030 |
aataaatttaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
30218964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 31784249 - 31784307
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31784249 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31784307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 35699176 - 35699110
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35699176 |
aataaaaataaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 40493968 - 40493903
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40493968 |
aataaaataa-ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40493903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Original strand, 9714859 - 9714916
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
9714859 |
taaaattaaggcttaattgcacttttgaactcctatctttccaaaagttgcggctatg |
9714916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 382 - 439
Target Start/End: Original strand, 19025821 - 19025878
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
19025821 |
aaaggcttaattgcactttttgacccctatcttttcaaaagttgcggttatgaacccc |
19025878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 25429921 - 25429970
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25429921 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25429970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 36566766 - 36566709
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
36566766 |
aaggcttaattgcacttctggacccctatctttccaaaagttgcggttatgaccccct |
36566709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 42445370 - 42445427
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42445370 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42445427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 45127151 - 45127094
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
45127151 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45127094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 17798848 - 17798896
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17798848 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17798896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 24858190 - 24858134
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24858190 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
24858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 24895225 - 24895169
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
24895225 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 375 - 431
Target Start/End: Complemental strand, 40445876 - 40445820
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||| ||||| |
|
|
| T |
40445876 |
ataaaataaaggcttaattgcacttttggacccctatctttctaaaagttgtggtta |
40445820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 375 - 431
Target Start/End: Complemental strand, 40506507 - 40506451
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
40506507 |
ataaaataaaggtttaattgcacttttggtctcctatctttctaaaagttgcggtta |
40506451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 41071828 - 41071884
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
41071828 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
41071884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 41072142 - 41072086
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
41072142 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
41072086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 1375046 - 1375101
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
1375046 |
ggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
1375101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 22194761 - 22194706
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
22194761 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22194706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 24857872 - 24857931
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
24857872 |
aataaaaaaaaggtttaattgcacttttggacctctatctttccaaaagttgcggttatg |
24857931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 25430086 - 25430035
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
25430086 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatg |
25430035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 36987412 - 36987467
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
36987412 |
ggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccct |
36987467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 39642729 - 39642784
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
39642729 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
39642784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1375402 - 1375344
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1375402 |
aaagacttaattgaacttttggacccctatctttccaaaagttgcggttatggacccct |
1375344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 17799144 - 17799094
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17799144 |
aaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17799094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 19368809 - 19368751
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||| |||||||||||||||||| ||||| |
|
|
| T |
19368809 |
aaaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatgaccccct |
19368751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 20436047 - 20436113
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||| |
|
|
| T |
20436047 |
aataaaatttaggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
20436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 22093542 - 22093476
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
22093542 |
aataaaaagaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
22093476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 39620542 - 39620600
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
39620542 |
aaaggcttaattgcacttttgggtccctatctttccaaaagttgcggttatggacccct |
39620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 315021 - 315066
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
315021 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
315066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 1375472 - 1375419
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1375472 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1375419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 1467123 - 1467066
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
1467123 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
1467066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 2936787 - 2936844
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
2936787 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
2936844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 3263034 - 3263083
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
3263034 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3263083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 429
Target Start/End: Complemental strand, 9715163 - 9715118
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9715163 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggt |
9715118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 25887893 - 25887942
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
25887893 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggttatg |
25887942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 26717455 - 26717406
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
26717455 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatg |
26717406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 432
Target Start/End: Complemental strand, 38731594 - 38731545
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
38731594 |
aaggcttaattgcacttttggactcctatcttttcaaaagttgcagttat |
38731545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 45395233 - 45395286
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |||||| |
|
|
| T |
45395233 |
cttaattgcacttttggacccctacctttccaaaagttgcggttatgtacccct |
45395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 1374801 - 1374853
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1374801 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
1374853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 7537412 - 7537468
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| | |||||| |
|
|
| T |
7537412 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
7537468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 13732481 - 13732425
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
13732481 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
13732425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 22093234 - 22093290
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
22093234 |
aggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22093290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 34123245 - 34123296
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
34123245 |
ttaattgcacttttggac-cctatctttccaaaagttgcggttatggacccct |
34123296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 34850970 - 34850922
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
34850970 |
ggcttaattgcacttttggacccctatctttccaaaagttgcagttatg |
34850922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 39431172 - 39431224
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
39431172 |
ttaattgcacttttgaacttctatctttccaaaagttgcggttatggacccct |
39431224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 40445572 - 40445628
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
40445572 |
aggcttaattgcacttttggacccatatctttccaaacgttgcggttatgaccccct |
40445628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42445686 - 42445630
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
42445686 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
42445630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 375 - 427
Target Start/End: Original strand, 44244940 - 44244992
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44244940 |
ataaaatctaggcttaattgcacttttggtctcctatctttccaaaagttgcg |
44244992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 5036506 - 5036557
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5036506 |
aaaggcttaattgcacttttggactcttatctttttaaaagttgcggttatg |
5036557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 21552541 - 21552596
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
21552541 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
21552596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 21552854 - 21552799
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
21552854 |
ggcttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
21552799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 21568246 - 21568183
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||||||| ||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
21568246 |
aaaataaaagcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
21568183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 38731279 - 38731326
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
38731279 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 40493646 - 40493701
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
40493646 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
40493701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 40506204 - 40506251
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
40506204 |
gcttaattgcacttttggaccccaatctttccaaaagttgcggttatg |
40506251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 41829467 - 41829522
Alignment:
| Q |
384 |
aggcttaattgcactttt-ggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
41829467 |
aggcttaattgcactttttggacccctatctttccaaaagttgcggttatggaccc |
41829522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 45126835 - 45126894
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| | ||||||||||||||||||| |||||| |
|
|
| T |
45126835 |
taaatgcttaattgcacttttggacccctatatatccaaaagttgcggttatggacccct |
45126894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 45395555 - 45395496
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| ||||||||||| |||||| |
|
|
| T |
45395555 |
taaaggcttaattgcacttttggatccctatctttctaaaaattgcggttatggacccct |
45395496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 434
Target Start/End: Complemental strand, 8739139 - 8739093
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
8739139 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
8739093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 11366796 - 11366854
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
11366796 |
aaggcttaattacacttttggaccccctatctttccaaaagttgcggttatggacccct |
11366854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 438
Target Start/End: Complemental strand, 11367114 - 11367060
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||| |||| |||| |
|
|
| T |
11367114 |
aggcttaattgcacttttggacccttatctttccaaaagttgcggctatggaccc |
11367060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 13485489 - 13485431
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
13485489 |
aaaggcttaattgcacttttatacccctatcttttcaaaagttgcggttatggacccct |
13485431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 15977521 - 15977467
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
15977521 |
gcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
15977467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 24894959 - 24895017
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
24894959 |
ataaaaaaaatgcttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
24895017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 36589729 - 36589779
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
36589729 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
36589779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 36590027 - 36589977
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
36590027 |
aaggcttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
36589977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 40711333 - 40711391
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| | |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40711333 |
aaaggcttaattgtatttttggacccctatcttttcaaaagttgcggttatggacccct |
40711391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 315317 - 315268
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
315317 |
aggcttaattgcacttttggacccatatctttctaaaagttgcggttatg |
315268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 8519269 - 8519314
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
8519269 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
8519314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 11362564 - 11362609
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11362564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
11362609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 19473325 - 19473280
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
19473325 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatg |
19473280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 370 - 427
Target Start/End: Complemental strand, 19889546 - 19889489
Alignment:
| Q |
370 |
tacaaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | | ||||||| ||||||||||| |
|
|
| T |
19889546 |
tacatataaaataaaggcttaattgcacttttggccccatatcttttcaaaagttgcg |
19889489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 33004708 - 33004757
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
33004708 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatg |
33004757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 33005007 - 33004950
Alignment:
| Q |
384 |
aggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
33005007 |
aggcttaattgcacttttggatcccctatcttttcaaaagttgcggttatggacccct |
33004950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 36286470 - 36286425
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36286470 |
aaaggcttaattgcacttttggccccctatctttccaaaagttgcg |
36286425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 39245979 - 39245930
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
39245979 |
aggcttaattgcacttttggacccatatctttccaaaagttgcgattatg |
39245930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 40324941 - 40324888
Alignment:
| Q |
388 |
ttaattgcactttt-ggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
40324941 |
ttaattgcactttttggacccctatctttccaaaagttgcggttatggacccct |
40324888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 2382871 - 2382815
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
2382871 |
aggcttaattgcacttttaaacccctatatttccaaaagttgcggttatggacccct |
2382815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 10741392 - 10741336
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||||||| ||| ||||| |
|
|
| T |
10741392 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcggttttgaccccct |
10741336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 19473076 - 19473124
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
19473076 |
ggcttaattgcatttttggacccctatctttctaaaagttgcggttatg |
19473124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 22194447 - 22194503
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| || |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
22194447 |
aggcttaatttcatttttggacccctatcttttcaaaagttgcggttatggacccct |
22194503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 24365180 - 24365128
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
24365180 |
ttaattgcatttttggacctctatctttccaaaagttgcggttatgaccccct |
24365128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 423
Target Start/End: Original strand, 26717156 - 26717196
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26717156 |
aaggcttaattgcacttttggacccctatctttccaaaagt |
26717196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 31784565 - 31784509
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31784565 |
aggcttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
31784509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 34850669 - 34850725
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||| |||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
34850669 |
aaaaaaaaggtttaattgcacttttggacccttatttttccaaaagttgcggttatg |
34850725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 37343998 - 37343954
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
37343998 |
aaggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
37343954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 40324633 - 40324689
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
40324633 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcgattatggacccct |
40324689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 41829775 - 41829723
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
41829775 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
41829723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 11017597 - 11017652
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||| ||||||||||||| |||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
11017597 |
aaaaaaaaggcttaattgtacttttggaccccaatctttcaaaaagttgcggttat |
11017652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 431
Target Start/End: Original strand, 17096910 - 17096957
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
17096910 |
aggcttaattgcacttttggatccctaactttccaaaagttgcggtta |
17096957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 20494339 - 20494394
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
20494339 |
ggcttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
20494394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 383 - 438
Target Start/End: Original strand, 22136891 - 22136946
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| | |||||| |||| |
|
|
| T |
22136891 |
aaggcttaattgcacttttagacccctatctttccaaaagttacagttatggaccc |
22136946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 34600546 - 34600589
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
34600546 |
aggcttaattgcacttttggccccctatctttccaaaagttgcg |
34600589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 2937104 - 2937047
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
2937104 |
aaaggcttaattgca-ttttggacctctatctttctaaaagttgcggttatggacccct |
2937047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 10857339 - 10857381
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
10857339 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
10857381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 17102622 - 17102576
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
17102622 |
ggcttaattgcacttttgaacccctaactttccaaaagttgcggtta |
17102576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 432
Target Start/End: Complemental strand, 19026133 - 19026083
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
19026133 |
aaaggtttaattgcacttttgaatccctatctttccaaaagttgcggttat |
19026083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 427
Target Start/End: Complemental strand, 32661748 - 32661706
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
32661748 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
32661706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 433
Target Start/End: Original strand, 36566605 - 36566651
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
36566605 |
cttaattgcacttctggacccctatcttttcaaaagttgcggttatg |
36566651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 9484703 - 9484756
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||| |||||| |
|
|
| T |
9484703 |
cttaattgcacttttaaacctctatctttccaaaagttgcggttatggacccct |
9484756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 426
Target Start/End: Original strand, 16865319 - 16865360
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
16865319 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
16865360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 23000530 - 23000575
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
23000530 |
ttaattgcacttttggacccttatttttccaaaagttgcggttatg |
23000575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 2755265 - 2755221
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
2755265 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
2755221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 8738847 - 8738895
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| ||||| |||||||||| |
|
|
| T |
8738847 |
aggcttaattgcacttttggacccctacctttacaaaaattgcggttat |
8738895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 15977207 - 15977263
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||| |||||| |||||| |
|
|
| T |
15977207 |
aggcttaattgcacttttggacccctatttttccagaagttgtagttatggacccct |
15977263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20436367 - 20436311
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||| |||||||||| |||||| |||||| |
|
|
| T |
20436367 |
aggcttaattacacttttggacccctattttttcaaaagttgctgttatggacccct |
20436311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 375 - 427
Target Start/End: Original strand, 31025865 - 31025917
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
31025865 |
ataaaatttaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
31025917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 32661402 - 32661446
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
32661402 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
32661446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 380 - 440
Target Start/End: Complemental strand, 39620866 - 39620806
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||||||||||| |||| ||| ||||| ||||||||||| |||||| |
|
|
| T |
39620866 |
ataaaggctaaattgcacttttggacctctattttttcaaaatttgcggttatggacccct |
39620806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 427
Target Start/End: Complemental strand, 3414910 - 3414871
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
3414910 |
ttaattgcacttttgaacccctatctttccaaaagttgcg |
3414871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 387 - 438
Target Start/End: Original strand, 13123424 - 13123475
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| ||||||| |||| |
|
|
| T |
13123424 |
cttaattgcacttttggacccctatctttttaaaagttgaggttatggaccc |
13123475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 397 - 440
Target Start/End: Complemental strand, 24205597 - 24205554
Alignment:
| Q |
397 |
cttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggacccct |
24205554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 427
Target Start/End: Complemental strand, 37552061 - 37552014
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| ||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
37552061 |
ataatggcttaattgcacttttggcctcatatcttttcaaaagttgcg |
37552014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 39431482 - 39431427
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
39431482 |
ggcttaattgcacttttgaacctctatctttttaaaagttgcggttatggacccct |
39431427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 41454511 - 41454554
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
41454511 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
41454554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 11362877 - 11362819
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||| |||||||||| |||||| || ||||||||||||||||| |||||| |
|
|
| T |
11362877 |
aaagacttaattatacttttggacccctatcatttcaaaagttgcggttatggacccct |
11362819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 28451631 - 28451681
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| ||| |||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
28451631 |
aaaaaaaaagcttaattgcacttttggccccctatctttctaaaagttgcg |
28451681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 34470029 - 34470071
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
34470029 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
34470071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 34981386 - 34981431
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
34981386 |
gcttaattgcatttttggac-cctatcttttcaaaagttgcggttat |
34981431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Complemental strand, 35180598 - 35180557
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35180598 |
ggcttaattgcacttttggcc-cctatctttccaaaagttgcg |
35180557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 403
Target Start/End: Original strand, 44077059 - 44077089
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttgg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44077059 |
aaataaaataaaggcttaattgcacttttgg |
44077089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 34123555 - 34123506
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||| |||||||||||||||| |
|
|
| T |
34123555 |
aggcttaattgcacttttagacccctattttttaaaaagttgcggttatg |
34123506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 34981692 - 34981647
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
34981692 |
ttaattgcatttttagacccctatcttttcaaaagttgcggttatg |
34981647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 39374098 - 39374155
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||| || ||| ||||| |
|
|
| T |
39374098 |
aaggcttaattgcacttttggccctctatcttttcaaaagttgcgattttgatcccct |
39374155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 374 - 427
Target Start/End: Complemental strand, 41454866 - 41454813
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| || ||||||||||||||| ||||| | ||||||||| ||||||||||| |
|
|
| T |
41454866 |
aataatattaaggcttaattgcacgtttggccccctatcttttcaaaagttgcg |
41454813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 427
Target Start/End: Original strand, 37334599 - 37334646
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
37334599 |
aatataggcttaattgcacttttgg-cccctatcttttcaaaagttgcg |
37334646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 55; Significance: 2e-22; HSPs: 196)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 7666197 - 7666255
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7666197 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
7666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 35364509 - 35364453
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
35364509 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
35364453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 37973829 - 37973773
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37973829 |
aggcttagttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
37973773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 11529756 - 11529814
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11529756 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11529814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 14578427 - 14578493
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14578427 |
aataaaaaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
14578493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 27246856 - 27246914
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27246856 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27246914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 41205812 - 41205754
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
41205812 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 51696526 - 51696584
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
51696526 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
51696584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 41205496 - 41205553
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
41205496 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 52310799 - 52310856
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52310799 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52310856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 104199 - 104255
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
104199 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
104255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 23315692 - 23315636
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
23315692 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23315636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 24415388 - 24415332
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
24415388 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
24415332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 37289454 - 37289510
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
37289454 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37289510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42672382 - 42672326
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42672382 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 51537429 - 51537485
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
51537429 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
51537485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 52045720 - 52045776
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52045720 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52045776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 52311116 - 52311060
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52311116 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52311060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 6386727 - 6386786
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
6386727 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
6386786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 11159733 - 11159678
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11159733 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11159678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 12640809 - 12640868
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
12640809 |
aataatataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
12640868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 17262398 - 17262343
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
17262398 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17262343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 51537929 - 51537874
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51537929 |
ggcttaatttcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51537874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 104524 - 104458
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
104524 |
aataaaaataaggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
104458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 7396139 - 7396189
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7396139 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 7705589 - 7705643
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
7705589 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
7705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 7705913 - 7705847
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7705913 |
aataaaaataaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
7705847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 11530076 - 11530018
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11530076 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11530018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 438
Target Start/End: Complemental strand, 12641133 - 12641079
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
12641133 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
12641079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 20474027 - 20473969
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20474027 |
aaaggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
20473969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 433
Target Start/End: Original strand, 21536874 - 21536928
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21536874 |
aataatggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21536928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 433
Target Start/End: Original strand, 50513039 - 50513093
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
50513039 |
aataaaggcttaattgcacttttggactcctatcttttcaaaagttgcagttatg |
50513093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 52046032 - 52045974
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
52046032 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 4902470 - 4902421
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4902470 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4902421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 5344586 - 5344529
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
5344586 |
aaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
5344529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 13021293 - 13021244
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13021293 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
13021244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 386 - 439
Target Start/End: Complemental strand, 31844099 - 31844046
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
31844099 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
31844046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 34362818 - 34362875
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34362818 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34362875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 45289815 - 45289758
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45289815 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Original strand, 47853967 - 47854024
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
47853967 |
taaaacaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
47854024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 52114449 - 52114392
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52114449 |
aaggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
52114392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 233005 - 232949
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
233005 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
232949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 1377604 - 1377660
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1377604 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
1377660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 7119585 - 7119649
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||| ||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7119585 |
taaattaaaggcttaattgtacttttggatccctatctttccaaaagttgcggttatggacccct |
7119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 7644456 - 7644512
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
7644456 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
7644512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 13607916 - 13607972
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
13607916 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
13607972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 17554037 - 17554093
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
17554037 |
aaaaaaaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17554093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 18988178 - 18988234
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
18988178 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18988234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20472860 - 20472804
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20472860 |
aggcttaattgtacttttggacccctatctttccaaaagttgcggttatggacccct |
20472804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 22160142 - 22160086
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
22160142 |
aggcttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
22160086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 26675052 - 26675108
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
26675052 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
26675108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 26675369 - 26675314
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
26675369 |
aggcttaattgcacttttggac-cctatctttccaaaagttgcggttatggacccct |
26675314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 27247172 - 27247124
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27247172 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27247124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 27751474 - 27751422
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27751422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29548494 - 29548438
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
29548494 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
29548438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 31250783 - 31250727
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31250783 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31250727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 34957667 - 34957615
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
34957667 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
34957615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 43821719 - 43821767
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43821719 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43821767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 43822012 - 43821956
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
43822012 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaccccct |
43821956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 47854294 - 47854238
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
47854294 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
47854238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 51696843 - 51696787
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
51696843 |
aggcttaatagcacttttggacccctatctttccaaaagttgcggttatggacccct |
51696787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 54215955 - 54216011
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
54215955 |
aggcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
54216011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 55586607 - 55586671
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
55586607 |
taaaagaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
55586671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 55586931 - 55586875
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
55586931 |
aggcttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
55586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 432
Target Start/End: Original strand, 5344266 - 5344317
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
5344266 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
5344317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 7666511 - 7666456
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
7666511 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
7666456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 30998508 - 30998449
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| | |||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30998508 |
aataaatttaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
30998449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 383 - 438
Target Start/End: Complemental strand, 39136612 - 39136557
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
39136612 |
aaggcttaattgcacttttggacccctatctttccaaaagtagcggttatggaccc |
39136557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 47821640 - 47821581
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
47821640 |
taaaggcttaattgcacttttagacccctatctttccgaaagttgcggttatgaccccct |
47821581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 48278229 - 48278174
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
48278229 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
48278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 432
Target Start/End: Complemental strand, 37432542 - 37432484
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
37432542 |
aataaaattaagacttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 39136297 - 39136351
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
39136297 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
39136351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 44921925 - 44921875
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
44921925 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
44921875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 54556939 - 54556873
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
54556939 |
aataaaaacaaggcttaattgcacttttggacctctatctttctaaaagttgcggttatggacccct |
54556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 387 - 433
Target Start/End: Original strand, 56296619 - 56296665
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
56296619 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 4902135 - 4902184
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
4902135 |
aggcttaattgcacttttggacccctatctttccaaaagttgctgttatg |
4902184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 7644782 - 7644717
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| || ||||||||||||||||||| || |||||||||| |||||||||||||||| |||||| |
|
|
| T |
7644782 |
ataaattataggcttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
7644717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 8891656 - 8891709
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
8891656 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8891709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 10046250 - 10046201
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
10046250 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
10046201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 20472552 - 20472597
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20472552 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20472597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 23770077 - 23770032
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23770077 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23770032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 24415072 - 24415121
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
24415072 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatg |
24415121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 27751157 - 27751218
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||| ||||||| |||||| |
|
|
| T |
27751157 |
aataaaggcttaattgcacttttggacctctatgtttccaaaagttgtggttatggacccct |
27751218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 375 - 432
Target Start/End: Original strand, 29548170 - 29548227
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||| | |||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
29548170 |
ataaaaaataggcttaattgcacttttggacccttatctttccaaaagttgcggttat |
29548227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 379 - 440
Target Start/End: Complemental strand, 31209537 - 31209476
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| | ||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
31209537 |
aataaatgtttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
31209476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 377 - 430
Target Start/End: Complemental strand, 33338351 - 33338298
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
33338351 |
aaaattaaggcttaattgcacttttggacccctatctttctaaaagttgcggtt |
33338298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 41707720 - 41707773
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41707720 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 47821474 - 47821523
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
47821474 |
aggcttaattgcacttttggacccctatctttcaaaaagttgcggttatg |
47821523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 50513353 - 50513300
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
50513353 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
50513300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 54556613 - 54556662
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
54556613 |
aggcttaattgcacttttggacccctatttttccaaaagttgcggttatg |
54556662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 374 - 426
Target Start/End: Original strand, 2016244 - 2016296
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
2016244 |
aataaaataaaggcttaattgcacttttggccccctatcttttcaaaagttgc |
2016296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 375 - 431
Target Start/End: Original strand, 3065950 - 3066006
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||| || |||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3065950 |
ataaattataggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 14578754 - 14578698
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
14578754 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
14578698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 18994670 - 18994722
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18994670 |
ttaattgcacttttggacccctatctttcgaaaagttgcggttatgaccccct |
18994722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 24542753 - 24542809
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |
|
|
| T |
24542753 |
aggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
24542809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 29432050 - 29432102
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
29432050 |
ttaattgcacttttggacccctatctttccaaaaattgcggttgtgaacccct |
29432102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29627921 - 29627865
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
29627921 |
aggcttagttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
29627865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 34363131 - 34363083
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
34363131 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
34363083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 34957377 - 34957432
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||| |
|
|
| T |
34957377 |
aggcttaattgcacttttgga-tcctatcttttcaaaagttgcggttatggacccct |
34957432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 38371270 - 38371326
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
38371270 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
38371326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 45289499 - 45289555
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45289499 |
aggcttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 3770473 - 3770418
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||||||||||| ||||| |
|
|
| T |
3770473 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgaccccct |
3770418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 439
Target Start/End: Original strand, 8482858 - 8482913
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
8482858 |
aggcttaattgcacttttggacccctattttttcaaaagttgcggttatggacccc |
8482913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 17266060 - 17266013
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
17266060 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 17554359 - 17554304
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
17554359 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
17554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 18995116 - 18995061
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| | |||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
18995116 |
ggcttaattgtatttttggacccctatctttccaaaagttgcggttatgaccccct |
18995061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 20466385 - 20466440
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20466385 |
ggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
20466440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 22159830 - 22159877
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
22159830 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
22159877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 31209220 - 31209279
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||| |||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
31209220 |
taaatgcttaattggacttttggacccatatctttccaaaagttgcggttatggacccct |
31209279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 429
Target Start/End: Complemental strand, 33508262 - 33508215
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33508262 |
aaaggcttaatttcacttttggacccctatctttccaaaagttgcggt |
33508215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 35364196 - 35364251
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
35364196 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
35364251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 39946390 - 39946335
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| ||||||| |||||| |
|
|
| T |
39946390 |
ggcttaattgcacttttggacccttatctttccaaaagttgtggttatggacccct |
39946335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 432
Target Start/End: Original strand, 42672060 - 42672115
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
42672060 |
aaaaaaaagacttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 50996035 - 50996090
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
50996035 |
ggcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
50996090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 37289768 - 37289714
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37289768 |
gcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
37289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 39332621 - 39332563
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||| ||||||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
39332621 |
ataaaatataggcttaattgcacttttgaacccctatctttttaaaagttgcggttatg |
39332563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 46282758 - 46282808
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
46282758 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
46282808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 392 - 438
Target Start/End: Complemental strand, 51537737 - 51537691
Alignment:
| Q |
392 |
ttgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
51537691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 6387047 - 6386990
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| || |||||||| |||||||||||||||| |||||| |
|
|
| T |
6387047 |
aggcttaattgcacttttggaccccctatctttctaaaagttgcggttatggacccct |
6386990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 7119908 - 7119859
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
7119908 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
7119859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 13608235 - 13608186
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13608235 |
aggcttaattacacttttggactcctatctttttaaaagttgcggttatg |
13608186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 374 - 439
Target Start/End: Complemental strand, 17221626 - 17221561
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
||||| ||||||||||||||| ||||||||| | ||||||| ||||||||||||||||| ||||| |
|
|
| T |
17221626 |
aataatataaaggcttaattgtacttttggatccttatcttttcaaaagttgcggttatggacccc |
17221561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 19869468 - 19869423
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
19869468 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
19869423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 31250481 - 31250526
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31250481 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatg |
31250526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 35835774 - 35835831
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| || |||||||| |||||| |
|
|
| T |
35835774 |
aaggcttaattgcacttttggacccctatcttttcaaaatttacggttatggacccct |
35835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 39332318 - 39332367
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39332318 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatg |
39332367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 41787048 - 41787097
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
41787048 |
aggcttaattgcacttttggacccctatctttcaaaaaattgcggttatg |
41787097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 1377901 - 1377845
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||| |||||||||||||||||| ||||| |
|
|
| T |
1377901 |
aggctaaattgcactttaggacccctatcttttcaaaagttgcggttatgaccccct |
1377845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 6768800 - 6768852
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||||||||||| |||||| |
|
|
| T |
6768800 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
6768852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 10045956 - 10046003
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
10045956 |
ggcttaattgcacttttggacccctatctttcc-aaagttgcggttatg |
10046003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 13019273 - 13019321
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
13019273 |
ggcttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
13019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 17262089 - 17262145
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
17262089 |
aggcttaattgcactcttggaccactatcttttcaaaagttgcggttatggacccct |
17262145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 26171240 - 26171296
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||| |||||| |||||| |
|
|
| T |
26171240 |
aggcttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
26171296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29432361 - 29432305
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |
|
|
| T |
29432361 |
aggcttaattgcacttttggatccctatcttttcaaaagttacggttatggacccct |
29432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 30998182 - 30998238
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
30998182 |
aggcttaactgcacttttagacctctatctttccaaaagttgcggttatggacccct |
30998238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 34158474 - 34158526
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
34158474 |
ttaattgcatttttggacccctatctttccaaaaattgcggttatggacccct |
34158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 37973516 - 37973560
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
37973516 |
ttaattgcacttttggacccctatctttctaaaagttgcggttat |
37973560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 431
Target Start/End: Complemental strand, 3066841 - 3066794
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||||||||||||||| |
|
|
| T |
3066841 |
aggcttaattgcacttttggacccataactttccaaaagttgcggtta |
3066794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 8891966 - 8891911
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
8891966 |
ggcttaattgcactttaggacccctatcttttcaaaagttgtggttatggacccct |
8891911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 425
Target Start/End: Complemental strand, 9119749 - 9119706
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
9119749 |
aaaggcttaattgcacttttggcctcttatctttccaaaagttg |
9119706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 17265850 - 17265897
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
17265850 |
gcttaattgtacttttggacccctatctttctaaaagttgcggttatg |
17265897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 18988493 - 18988438
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||| |||| |||||| |
|
|
| T |
18988493 |
ggcttaattgcacttttggacccctatctttttaaaagttgcggctatggacccct |
18988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 33338049 - 33338104
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||||| | ||| |||||||||||||||||||||| ||||| |
|
|
| T |
33338049 |
ggcttaattgtacttttggacccatatatttccaaaagttgcggttatgaccccct |
33338104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 35083894 - 35083839
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||| ||||| |||||| |
|
|
| T |
35083894 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcgattatggacccct |
35083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 439
Target Start/End: Original strand, 39946079 - 39946134
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
39946079 |
aggcttaattgcacttttggaccattatctttctaaaagttgcggttatggacccc |
39946134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 54216270 - 54216215
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||||||||||||| |||||| |
|
|
| T |
54216270 |
ggcttaattgcacttttgaacctctatcttttcaaaagttgcggttatggacccct |
54216215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 19693018 - 19693072
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| ||||| | |||||| |
|
|
| T |
19693018 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 19703603 - 19703657
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| ||||| | |||||| |
|
|
| T |
19703603 |
gcttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19703657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 423
Target Start/End: Original strand, 19725651 - 19725697
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||||| |||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
19725651 |
aaaatataggcttaattgcacttttggccccctatctttccaaaagt |
19725697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 21537191 - 21537149
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
21537191 |
aggcttaattgcacttttggacccctatcttttcaaaagttgc |
21537149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 34158796 - 34158738
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||| ||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
34158796 |
ataaaatttaggtttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
34158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 427
Target Start/End: Complemental strand, 36414021 - 36413979
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
36414021 |
ggcttaattgcacttttggccccctatctttccaaaagttgcg |
36413979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 44822438 - 44822480
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
44822438 |
aggcttaattgcacctttggacccctatctttccaaaagttgc |
44822480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 439
Target Start/End: Original strand, 48277916 - 48277970
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| ||||||||| ||||||| ||||| |
|
|
| T |
48277916 |
ggcttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccc |
48277970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 1988268 - 1988215
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||| | ||| |||| ||||||||||||||||||||| |
|
|
| T |
1988268 |
ggcttaattgcacttttggaaccttatttttctaaaagttgcggttatgaaccc |
1988215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 3770178 - 3770227
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| ||||| |
|
|
| T |
3770178 |
aggcttaattgcacttttggacccctatctttcttaaagttgcgattatg |
3770227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 6769107 - 6769054
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
6769107 |
cttaattacacttttggacccctatcttttcaaaagttgtggttatggacccct |
6769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 378 - 427
Target Start/End: Complemental strand, 9592451 - 9592402
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||| ||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
9592451 |
aaataatggcttaattgcacttttggccccctatcttttcaaaagttgcg |
9592402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 23419645 - 23419592
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
23419645 |
cttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
23419592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 24543053 - 24543008
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
24543053 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatg |
24543008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 28158899 - 28158944
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28158899 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
28158944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 28981912 - 28981961
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
28981912 |
aggcttatatgcacttttggacccctatcttttcaaaagttgcggttatg |
28981961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 34625285 - 34625240
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
34625285 |
aaaggtttaattgcacttttggcctcctatcttttcaaaagttgcg |
34625240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 38371579 - 38371522
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||| ||||||||||| |||||| |
|
|
| T |
38371579 |
aaggcttaatcgcacttttggacctctatcttttcaaaaattgcggttatggacccct |
38371522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 40350838 - 40350891
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||| |||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
40350838 |
cttaactgcacttttggattcctattttttcaaaagttgcggttatggacccct |
40350891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 8483174 - 8483126
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| |||||||||||||||| |
|
|
| T |
8483174 |
aggcttaattgcacttttggacctctattttttcaaaagttgcggttat |
8483126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 24296815 - 24296771
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24296815 |
aaggcttaattgcacttttgacctcctatcttttcaaaagttgcg |
24296771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 35083579 - 35083635
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| || |||||||||| ||||||| ||||||| |||||| |
|
|
| T |
35083579 |
aggcttaattgcacttttgaacctctatctttccgaaagttggggttatggacccct |
35083635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 56296919 - 56296863
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||| ||||||||| || ||||| ||||||||| ||||||||||||||||| |
|
|
| T |
56296919 |
aaaaaaaaggtttaattgcatttctggacccctatcttttcaaaagttgcggttatg |
56296863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 376 - 427
Target Start/End: Original strand, 29860643 - 29860694
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||| || |||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
29860643 |
taaaattaaagcttaattgcacttttggccccctatcttttcaaaagttgcg |
29860694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 434
Target Start/End: Original strand, 31560039 - 31560090
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||| ||||||| |||||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
31560039 |
aaggtttaattgtacttttggacccctttctttctaaaagttgcggttatga |
31560090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 39668872 - 39668927
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
39668872 |
ggcttaattgtacttttggatctctatctttctaaaaattgcggttatgaacccct |
39668927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 44921611 - 44921662
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
44921611 |
aaaggtttaattgcacttttggacccttatctttttaaaagttgcggttatg |
44921662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Complemental strand, 49869733 - 49869690
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
49869733 |
aggcttaattgcacttttgacctcctatcttttcaaaagttgcg |
49869690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 438
Target Start/End: Complemental strand, 54607193 - 54607138
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||| |||||| ||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
54607193 |
aaggtttaattttacttttggatccctatcttttcaaaagttgcggttatgaaccc |
54607138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Original strand, 24886531 - 24886573
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
24886531 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgc |
24886573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 433
Target Start/End: Complemental strand, 26171551 - 26171505
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
26171551 |
cttaattgcacttttggacctctatcttttcaaaagttacggttatg |
26171505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 427
Target Start/End: Complemental strand, 28291975 - 28291925
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| |||| |||||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
28291975 |
aaaattaaggtttaattgcacttttagccccctatctttccaaaagttgcg |
28291925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 31843785 - 31843835
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||| ||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
31843785 |
aaggtttaattacacttttggacccctatcttttcaaaagttgtggttatg |
31843835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 36945513 - 36945555
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
36945513 |
ggcttaattgcacttttggccccctatcttttcaaaagttgcg |
36945555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 432
Target Start/End: Original strand, 54606885 - 54606934
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||| | |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
54606885 |
aaaggcttaattgta-ttttggacccctatcttttcaaaagttgcggttat |
54606934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 426
Target Start/End: Complemental strand, 1187001 - 1186960
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
1187001 |
ggcttaattgcacttttggccccctatcttttcaaaagttgc |
1186960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 427
Target Start/End: Complemental strand, 10308676 - 10308635
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
10308676 |
gcttaattgcatttttggcctcctatctttctaaaagttgcg |
10308635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 386 - 427
Target Start/End: Original strand, 12892825 - 12892866
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
12892825 |
gcttaattgcacttttggccccctatcttttcaaaagttgcg |
12892866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 399 - 440
Target Start/End: Original strand, 19869191 - 19869232
Alignment:
| Q |
399 |
tttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
19869191 |
tttggacccctatctttccaaaagttacggttatgaccccct |
19869232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 440
Target Start/End: Complemental strand, 20466676 - 20466643
Alignment:
| Q |
407 |
cctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
20466676 |
cctatctttccaaaagttgcggttatggacccct |
20466643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 22589508 - 22589463
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| |||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
22589508 |
aaaggtttaattgcacttttggccccctatctttctaaaagttgcg |
22589463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 23769803 - 23769852
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||||||| ||||||| |
|
|
| T |
23769803 |
aggcttaattgcacttttggacccctatttttttaaaagttgtggttatg |
23769852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 46283057 - 46283006
Alignment:
| Q |
385 |
ggcttaattgcact---tttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||| |||||||||||||||| |
|
|
| T |
46283057 |
ggcttaattgcactatctttggacccctatctttctaaaagttgcggttatg |
46283006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 49869250 - 49869295
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
49869250 |
aaaggcttaattgcacttttggctccctatcttttcaaaagttgcg |
49869295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 427
Target Start/End: Original strand, 1186652 - 1186700
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||||| | |||| |||| |||||||||| |
|
|
| T |
1186652 |
aataaaggcttaattgcacttttggccccctaactttttaaaagttgcg |
1186700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 23777032 - 23777076
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| || ||||||| ||||||||||| |
|
|
| T |
23777032 |
aaggcttaattgcacttttggccttttatcttttcaaaagttgcg |
23777076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 26858342 - 26858386
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
26858342 |
aaggcttaattgcacttttggccccctatctttttaaaagttgcg |
26858386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 28982222 - 28982170
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||||||||||||||||| |||||| |
|
|
| T |
28982222 |
ttaattgcacttttggacctatattttttcaaaagttgcggttatggacccct |
28982170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 387 - 427
Target Start/End: Complemental strand, 29860892 - 29860852
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||||| |
|
|
| T |
29860892 |
cttaattgcacttttggccccccatctttccaaaagttgcg |
29860852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 44121102 - 44121046
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||| ||||||||||| || ||| ||||| |
|
|
| T |
44121102 |
aggcttaattacacttttggccccctatcttttcaaaagttgcgattttgaccccct |
44121046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 5590 - 5647
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5590 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
5647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 5909 - 5851
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
5909 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 54; Significance: 7e-22; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 9945 - 10002
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9945 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 10252 - 10202
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
10252 |
aaggcttaattgcatttttggacccctatctttctaaaagttgcggttatg |
10202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 54; Significance: 7e-22; HSPs: 169)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 37205864 - 37205799
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
37205864 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37205799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 39515870 - 39515812
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39515870 |
aaaggcttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
39515812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 45516244 - 45516178
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | ||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45516244 |
aataaaaaataggcttaattgcatttttggactcctatcttttcaaaagttgcggttatgaacccct |
45516178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 30359157 - 30359100
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
30359157 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30359100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 38166474 - 38166539
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
38166474 |
ataaaattaagacttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 1657699 - 1657643
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1657699 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1657643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 14032035 - 14032091
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14032035 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
14032091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 20095685 - 20095741
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20095685 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20095741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 30845874 - 30845818
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
30845874 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30845818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42267772 - 42267716
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42267772 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42267716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 414667 - 414722
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
414667 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
414722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 2321830 - 2321775
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
2321830 |
ggcttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
2321775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 5734498 - 5734443
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
5734498 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5734443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 6641911 - 6641856
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
6641911 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
6641856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 7151155 - 7151100
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7151155 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 383 - 438
Target Start/End: Original strand, 8870257 - 8870312
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
8870257 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
8870312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 17943354 - 17943413
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
17943354 |
taaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
17943413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 383 - 438
Target Start/End: Complemental strand, 32318821 - 32318766
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
32318821 |
aaggcttaattgcacttttggacccctatctttctaaaagttgcggttatgaaccc |
32318766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 32332132 - 32332195
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||| || |||||| |
|
|
| T |
32332132 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
32332195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 375 - 434
Target Start/End: Original strand, 35409703 - 35409762
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35409703 |
ataaaataaaggtttaattgcacttttggatccctatctttccaaaagttgcggttatga |
35409762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 39515558 - 39515613
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
39515558 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39515613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 40918687 - 40918632
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
40918687 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaccccct |
40918632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 378 - 440
Target Start/End: Original strand, 994986 - 995048
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
994986 |
aaataaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
995048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 6014408 - 6014474
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6014408 |
aataaaatctaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6014474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 379 - 433
Target Start/End: Original strand, 6107111 - 6107165
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6107111 |
aatataggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
6107165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 6107429 - 6107375
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6107429 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 23234096 - 23234038
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23234096 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23234038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 438
Target Start/End: Original strand, 38593186 - 38593240
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
38593186 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
38593240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 44885893 - 44885959
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | ||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
44885893 |
aataaaaaataggtttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
44885959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 2321514 - 2321571
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2321514 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2321571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 27822873 - 27822930
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27822873 |
aaggcttaattgcacttttggacccctatctttccaaaatttgcggttatggacccct |
27822930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 379 - 432
Target Start/End: Original strand, 36788248 - 36788301
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36788248 |
aataaagacttaattgcacttttggacccctatctttccaaaagttgcggttat |
36788301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 38166797 - 38166744
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
38166797 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 39616865 - 39616816
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39616865 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
39616816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 41625450 - 41625515
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41625450 |
ataaaacaaaggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
41625515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 42906370 - 42906427
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
42906370 |
aaggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
42906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 42906688 - 42906639
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42906688 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
42906639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 45209299 - 45209234
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
45209299 |
ataaaaaaaaggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
45209234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 414969 - 414913
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
414969 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
414913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 1985879 - 1985827
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1985879 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1985827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 4132753 - 4132809
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4132753 |
aggcttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
4132809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 20096000 - 20095952
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20096000 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20095952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 20283988 - 20283940
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20283988 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20283940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 20814063 - 20813999
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
20814063 |
taaaatattggcttaattgcacttttggacccctatctttccaaaacttgcggttatggacccct |
20813999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 21070616 - 21070568
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21070616 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21070568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 36226729 - 36226673
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
36226729 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
36226673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 37953373 - 37953429
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37953373 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 41206453 - 41206397
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
41206453 |
aaaataaaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
41206397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 42642402 - 42642346
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
42642402 |
aggcttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
42642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 45106434 - 45106490
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45106434 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45106490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 4133068 - 4133013
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4133068 |
ggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
4133013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 4167513 - 4167458
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4167513 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
4167458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 12330065 - 12330128
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||| |||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
12330065 |
aaaaaaaaggtttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
12330128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 14024353 - 14024298
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14024353 |
ggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14024298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 18531146 - 18531091
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
18531146 |
ggcttaattgcacttttggacccctatctttctaaaagttacggttatgaacccct |
18531091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 18553284 - 18553229
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
18553284 |
ggcttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
18553229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 20791013 - 20791064
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20791013 |
aaagacttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20791064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 20819748 - 20819807
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
20819748 |
taaaggcttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
20819807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 27339535 - 27339598
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
27339535 |
aaaatataggcttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
27339598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 383 - 438
Target Start/End: Original strand, 32318504 - 32318559
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||| || ||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32318504 |
aaggcttaatttcatttttggactcctatctttctaaaagttgcggttatgaaccc |
32318559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 35735504 - 35735558
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
35735504 |
ggcttaattgcacttttggac-cctatctttccaaaagttgcggttatggacccct |
35735558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 39626281 - 39626226
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |||||| |
|
|
| T |
39626281 |
ggcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39626226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 39635831 - 39635776
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| |||||||||| |||||| |
|
|
| T |
39635831 |
ggcttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39635776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 376 - 438
Target Start/End: Complemental strand, 8287926 - 8287864
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||| ||||||||| |||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
8287926 |
taaaaaaaaggcttagttgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 376 - 438
Target Start/End: Complemental strand, 8870583 - 8870521
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||| |||||||||||||| ||||| || ||||||||||||||||||||||||||| |||| |
|
|
| T |
8870583 |
taaaattaaggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggaccc |
8870521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 384 - 438
Target Start/End: Complemental strand, 20820066 - 20820012
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||| |
|
|
| T |
20820066 |
aggcttaattgcacttttgaacccctatctttccaaaagttgcggttatggaccc |
20820012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 36801398 - 36801452
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
36801398 |
gcttaattgcacttttggacccctatctttccacaagttgcggttatggacccct |
36801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 4107161 - 4107112
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
4107161 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
4107112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 6641598 - 6641651
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6641598 |
cttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
6641651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 15187927 - 15187976
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
15187927 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
15187976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 37953688 - 37953631
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37953688 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 4146784 - 4146840
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
4146784 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
4146840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 4147094 - 4147042
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
4147094 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
4147042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 6335642 - 6335586
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||| ||||| |||||| |
|
|
| T |
6335642 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
6335586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 429
Target Start/End: Complemental strand, 6745315 - 6745263
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
6745315 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggt |
6745263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 8833942 - 8833990
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
8833942 |
ggcttaattgcacttttggacacctatctttcaaaaagttgcggttatg |
8833990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 16531563 - 16531507
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
16531563 |
aggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
16531507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20791312 - 20791256
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
20791312 |
aggcttaattgcatttttggacctctatctttccaaaagttgcggttatgaccccct |
20791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 20813735 - 20813791
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20813735 |
aggcttaattgcacttgtggacccctatcttttcaaaagttgcggttatggacccct |
20813791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 29233545 - 29233597
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
29233545 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatgtacccct |
29233597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 30845554 - 30845602
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30845554 |
ggcttaattgtacttttggacccctatctttccaaaagttgcggttatg |
30845602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 378 - 430
Target Start/End: Original strand, 37639500 - 37639552
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| ||||||||| |||| |
|
|
| T |
37639500 |
aaataaaggcttaattgcacttttggacccctatcttttcaaaagttgaggtt |
37639552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 41693366 - 41693310
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||| |||| |
|
|
| T |
41693366 |
aggcttaattgcacttttggatccttatctttccaaaagttgcggttatgaagccct |
41693310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 42267455 - 42267511
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
42267455 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
42267511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 42525030 - 42524966
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||| |||||||||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
42525030 |
aaaaaaaaggtttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
42524966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 383 - 431
Target Start/End: Complemental strand, 43658496 - 43658448
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
43658496 |
aaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 44886214 - 44886162
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
44886214 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
44886162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 45208979 - 45209031
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
45208979 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
45209031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 6335333 - 6335380
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6335333 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
6335380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 6655599 - 6655536
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6655599 |
aaaaaaaaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6655536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 6736001 - 6735938
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| ||||||| ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
6736001 |
aaaaaaaaggcttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6735938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 23233781 - 23233828
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
23233781 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 31190643 - 31190690
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
31190643 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttat |
31190690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 431
Target Start/End: Original strand, 43657491 - 43657538
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
43657491 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 45480365 - 45480310
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| || |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45480365 |
ggcttaactgtacttttggacccctatctttccaaaagttgcggttatggacccct |
45480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 1657389 - 1657443
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
1657389 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
1657443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 5734181 - 5734239
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5734181 |
aaaggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
5734239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 14032345 - 14032291
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
14032345 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
14032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 17943655 - 17943597
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17943655 |
aaaggctaaattgcactttaggacccctatctttccaaaagttacggttatgaccccct |
17943597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 379 - 433
Target Start/End: Original strand, 27872704 - 27872758
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
27872704 |
aatataggcttaattgcacttttggatccctatctttctaaaagttgcggttatg |
27872758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 31191786 - 31191728
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
31191786 |
aaaggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
31191728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 387 - 433
Target Start/End: Original strand, 41206164 - 41206210
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
41206164 |
cttaattgcacttttggacccatatctttccaaaagttgcggttatg |
41206210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 41574468 - 41574410
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||| ||||| |||||| |
|
|
| T |
41574468 |
aaaggtttaattgcacttttggacccctatctttctaaaagttgcgattatggacccct |
41574410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 42866406 - 42866360
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
42866406 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 995305 - 995252
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
995305 |
cttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 8834250 - 8834197
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
8834250 |
cttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
8834197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 32693028 - 32692979
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
32693028 |
aggcttaattgtacttttggacccctatctttccaaaaattgcggttatg |
32692979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 33947038 - 33947099
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||| |||||||||| ||||||||||||||||||| | ||||| |||||| |
|
|
| T |
33947038 |
aatataggcttaattgtacttttggacccctatctttccaaaagttgagattatggacccct |
33947099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 41015101 - 41015056
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
41015101 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
41015056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 42363580 - 42363633
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||| |||||| |||||| |
|
|
| T |
42363580 |
cttaattgcacttttggacccttatctttccaaaagttgctgttatggacccct |
42363633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 6014732 - 6014676
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
6014732 |
aggcttaattgcacttttggatccctatctttttaaaagttgcggttatggacccct |
6014676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 14024195 - 14024247
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
14024195 |
ttaattgcacgtttggacccctatctttacaaaagttgcggttatggacccct |
14024247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 25249957 - 25250009
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
25249957 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
25250009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 432
Target Start/End: Complemental strand, 25250256 - 25250212
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
25250256 |
ttaattgcacttttggacctctatctttccaaaagttgcggttat |
25250212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29233819 - 29233763
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
29233819 |
aggcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
29233763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 33881397 - 33881345
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
33881397 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
33881345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 37205539 - 37205595
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
37205539 |
aggcttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
37205595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 38593499 - 38593451
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
38593499 |
aggcttaattgcacttttggacctctatatttccaaaagttgcggttat |
38593451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 39625970 - 39626022
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||| |||||| |
|
|
| T |
39625970 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 39635520 - 39635572
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||| |||||| |
|
|
| T |
39635520 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39635572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 388 - 431
Target Start/End: Complemental strand, 3345684 - 3345641
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3345684 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 28596243 - 28596188
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
28596243 |
ggcttaattgcacttttggatccctatctttctaaaagttgtggttatggacccct |
28596188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 29454344 - 29454392
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
29454344 |
aaggcttaattgcacttttggacccc--tctttccaaaagttgcggttatg |
29454392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 41788643 - 41788706
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||| |||||||||||||||| |||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
41788643 |
aaaaaaaagacttaattgcacttttgaactcctatctttttaaaagttgcagttatggacccct |
41788706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 388 - 435
Target Start/End: Complemental strand, 42930928 - 42930881
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaa |
435 |
Q |
| |
|
|||||||||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42930928 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatgaa |
42930881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 1985566 - 1985624
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||||| |||||||| ||| ||||||||||||| |||||| |
|
|
| T |
1985566 |
aaaggcttaattgtacttttggacctctatcttttcaatagttgcggttatggacccct |
1985624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 7013346 - 7013404
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| |||||||||||||| || |||||| |
|
|
| T |
7013346 |
aaaggcttaattgcacttttagatccctatcttttcaaaagttgcggttttggacccct |
7013404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 432
Target Start/End: Complemental strand, 7013666 - 7013616
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
7013666 |
aaaggcttaattgcacttttggatctctatcttttcaaaagttgcggttat |
7013616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 423
Target Start/End: Complemental strand, 7318948 - 7318910
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7318948 |
ggcttaattgcacttttggacccctatctttccaaaagt |
7318910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 37277457 - 37277515
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||||| ||||| ||| |||||||||||||||| |||||| |
|
|
| T |
37277457 |
aaaggcttaattgtacttttggacccctatttttttaaaagttgcggttatggacccct |
37277515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 430
Target Start/End: Complemental strand, 41554901 - 41554855
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
41554901 |
aggcttaattgcacttttggatccctatctttctaaaagttgcggtt |
41554855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 390 - 431
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 432
Target Start/End: Original strand, 4167202 - 4167251
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| ||||||||| |||||| |
|
|
| T |
4167202 |
aaggcttaattgcacttttggacgcctattttttcaaaagttgtggttat |
4167251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 7150840 - 7150897
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||| |||||||||| |||||| |||||| |
|
|
| T |
7150840 |
aaggcttaattgcatttttgaacccctatcttttcaaaagttgcagttatggacccct |
7150897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 7653669 - 7653621
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | |||| |||||||||||||||||||| |
|
|
| T |
7653669 |
aggcttaattgcacttttggacccttatc-ttccaaaagttgcggttatg |
7653621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 377 - 426
Target Start/End: Original strand, 18530824 - 18530873
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||| ||||||||||||||||||||| || ||||||||| |||||||||| |
|
|
| T |
18530824 |
aaaaaaaaggcttaattgcacttttgaacccctatcttttcaaaagttgc |
18530873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 27339856 - 27339803
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||| |||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
27339856 |
ggcttaattgcatttttggacccctatctttttaaaagttgcggttatggaccc |
27339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 438
Target Start/End: Original strand, 30358843 - 30358896
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||| | |||||| ||||||||||||||||| |||| |
|
|
| T |
30358843 |
ggcttaattgcacttttggacctcgatcttttcaaaagttgcggttatggaccc |
30358896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 16531248 - 16531296
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| | |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
16531248 |
ggcttaattgtatttttggacccctatcttttcaaaagttgcggttatg |
16531296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 419
Target Start/End: Original strand, 20283810 - 20283850
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaa |
419 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
20283810 |
aataaaggtttaattgcacttttggacccctatctttccaa |
20283850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 419
Target Start/End: Original strand, 21070438 - 21070478
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaa |
419 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
21070438 |
aataaaggtttaattgcacttttggacccctatctttccaa |
21070478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 25910281 - 25910333
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| |||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
25910281 |
ttaattgcacttttggagtcctttattttcaaaagttgcggttatggacccct |
25910333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 37277770 - 37277718
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
37277770 |
ttaattgcacttttggacccctatcttttcaaaagttatggttatggacccct |
37277718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 42363882 - 42363830
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |||||| |
|
|
| T |
42363882 |
ttaattgcacttttggacccctttctttttaaaagttgcggttatggacccct |
42363830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 42524709 - 42524757
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
42524709 |
aggcttaattgcacttttggatccctatctttctaaaagttgcgattat |
42524757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 42642091 - 42642147
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||| ||| |||||||||| |||||||| ||||||| |||||| |
|
|
| T |
42642091 |
aggcttaattgcacgttttgacccctatctttctaaaagttggggttatggacccct |
42642147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 18621720 - 18621763
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
18621720 |
aggcttaattgcacttttggtcccctatctttctaaaagttgcg |
18621763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 20056411 - 20056466
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||| || ||||||||||||| |||||| |
|
|
| T |
20056411 |
ggcttaattgcacttttggacccttatctttttaatagttgcggttatggacccct |
20056466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 31947853 - 31947896
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
31947853 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
31947896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 32498377 - 32498420
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
32498377 |
aggcttaattgcacttttggccccctatcttttcaaaagttgcg |
32498420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 32692732 - 32692779
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||| | |||||||||||||||| |||||||| ||||||| |
|
|
| T |
32692732 |
ggcttaattgcattattggactcctatcttttcaaaagttacggttat |
32692779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 33877812 - 33877761
Alignment:
| Q |
383 |
aaggcttaattgcacttttgga-ctcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||||| ||||||| |
|
|
| T |
33877812 |
aaggcttaattgcacttttggaccccctatcttttcaaaagttgtggttatg |
33877761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 376 - 427
Target Start/End: Complemental strand, 44807397 - 44807346
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
44807397 |
taaattaaaggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
44807346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 45106751 - 45106700
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| ||||||||||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
45106751 |
aaaggtttaattgcacttttgaacccctatctttttaaaagttgcggttatg |
45106700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 374 - 404
Target Start/End: Complemental strand, 3411728 - 3411698
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttgga |
404 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3411728 |
aataaaataaaggcttaattgcacttttgga |
3411698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 386 - 432
Target Start/End: Original strand, 8287605 - 8287651
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
8287605 |
gcttaattgcacttttgaactcctatctttttaaaagttgcgattat |
8287651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 427
Target Start/End: Complemental strand, 38701984 - 38701931
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||| | |||||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
38701984 |
aaataaaaaataggcttaattgcactttt-gacccctatcttttcaaaagttgcg |
38701931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 41554605 - 41554655
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
41554605 |
aaggcttaattgcactttcggacctttatcttttcaaaagttgcggttatg |
41554655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 373 - 423
Target Start/End: Complemental strand, 45022655 - 45022606
Alignment:
| Q |
373 |
aaataaaataaaggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
45022655 |
aaataaaa-aaaggtttaattgcccttttggacccctatctttccaaaagt |
45022606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 407 - 440
Target Start/End: Original strand, 3411423 - 3411456
Alignment:
| Q |
407 |
cctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
3411423 |
cctatctttccaaaagttgcggttatggacccct |
3411456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 425
Target Start/End: Complemental strand, 26920030 - 26919989
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
26920030 |
aggcttaattgcacttttggccccctatcttttcaaaagttg |
26919989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 27873023 - 27872974
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
27873023 |
aggcttaattgctcttttggatccctatctttctaaaagttgcagttatg |
27872974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 28595933 - 28595978
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
28595933 |
ttaattgcacttttgaacctctatcttttcaaaagttgcggttatg |
28595978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 40021830 - 40021785
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| ||| ||||||||||| |
|
|
| T |
40021830 |
aaaggcttaattgcacttttggtctcttattttttcaaaagttgcg |
40021785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 40918392 - 40918441
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| ||||||| |||||||| |
|
|
| T |
40918392 |
aggcttaatttcacttttggacccctatctttttaaaagttacggttatg |
40918441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 387 - 433
Target Start/End: Complemental strand, 41788960 - 41788912
Alignment:
| Q |
387 |
cttaattgcacttttggactcc--tatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
41788960 |
cttaattgcacttttggacccccctatcttttcaaaagttgcggttatg |
41788912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 45326190 - 45326146
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
45326190 |
aaaggcttaattgcacttttggtc-cctatctttccaaaaattgcg |
45326146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 36623903 - 36623946
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| ||||||||||| | ||||||||||| |
|
|
| T |
36623903 |
aaggcttaattgcactttt-gactcctatctcttcaaaagttgcg |
36623946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 425
Target Start/End: Complemental strand, 41368695 - 41368655
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
41368695 |
ggcttaattgcacttttgacctcatatctttccaaaagttg |
41368655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 179)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 20596185 - 20596121
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20596185 |
taaaatataggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20596121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 380 - 440
Target Start/End: Original strand, 23356688 - 23356748
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
23356688 |
ataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23356748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 381 - 440
Target Start/End: Complemental strand, 15161615 - 15161556
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
15161615 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15161556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 379 - 433
Target Start/End: Complemental strand, 922482 - 922428
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
922482 |
aataaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
922428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 11018398 - 11018456
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11018398 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11018456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 43914568 - 43914626
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43914568 |
ataaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43914626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 10279991 - 10279942
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10279991 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
10279942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 19830426 - 19830369
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19830426 |
aaggtttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
19830369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 23342276 - 23342219
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
23342276 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23342219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 26861272 - 26861329
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
26861272 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
26861329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 8774297 - 8774353
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
8774297 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8774353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 11204506 - 11204562
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11204506 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 376 - 440
Target Start/End: Complemental strand, 11204821 - 11204757
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11204821 |
taaaaaaaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 43677102 - 43677158
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43677102 |
aggcttaattgcacttttggatccctatctttccaaaagttgcggttatgaacccct |
43677158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 45885263 - 45885207
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
45885263 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 6491408 - 6491471
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
6491408 |
aaaaaaaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatgaacccct |
6491471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 9058166 - 9058221
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
9058166 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
9058221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 11052210 - 11052155
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11052210 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11052155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 26435003 - 26434948
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
26435003 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatgaccccct |
26434948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 32341495 - 32341550
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
32341495 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32341550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 32341813 - 32341750
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
32341813 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
32341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 42407198 - 42407143
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
42407198 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42407143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 52143486 - 52143423
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52143486 |
aaaatgaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52143423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 12690018 - 12690076
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
12690018 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
12690076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 27396841 - 27396791
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27396841 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27396791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 432
Target Start/End: Original strand, 45012629 - 45012679
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45012629 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 52233429 - 52233479
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
52233429 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
52233479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 11018717 - 11018660
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11018717 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11018660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 13791574 - 13791631
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13791574 |
aaggtttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
13791631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 379 - 440
Target Start/End: Original strand, 15161291 - 15161352
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
15161291 |
aatataggcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
15161352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 29794691 - 29794748
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
29794691 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29794748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Original strand, 36230543 - 36230600
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36230543 |
taaattaaaggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
36230600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 376 - 433
Target Start/End: Original strand, 39427402 - 39427459
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
39427402 |
taaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
39427459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 45664454 - 45664405
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
45664454 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
45664405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 47113390 - 47113443
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
47113390 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47113443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 6182982 - 6183030
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6182982 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
6183030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 7598608 - 7598664
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
7598608 |
aggcttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
7598664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 382 - 438
Target Start/End: Original strand, 8770460 - 8770516
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
8770460 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8770516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 11051895 - 11051943
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11051895 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
11051943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 16490973 - 16491029
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
16490973 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatgaacccct |
16491029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 20287766 - 20287822
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
20287766 |
aggcttaattgcacttttggaaccctacctttccaaaagttgcggttatgaacccct |
20287822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 22204304 - 22204360
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
22204304 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22204360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 23341963 - 23342019
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23341963 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23342019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 23793095 - 23793047
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23793095 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23793047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 386 - 438
Target Start/End: Complemental strand, 25098442 - 25098390
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
25098442 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
25098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 30288175 - 30288231
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||| |||||| |
|
|
| T |
30288175 |
aggcttaattgcacttttggacccctatctttccagaagttgcggttatggacccct |
30288231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 32558215 - 32558267
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
32558215 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 39427727 - 39427671
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
39427727 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39427671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 45884947 - 45885003
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45884947 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45885003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 46320676 - 46320724
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46320676 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
46320724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 46320990 - 46320934
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
46320990 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
46320934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 52143168 - 52143220
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
52143168 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52143220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 2371177 - 2371232
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
2371177 |
ggcttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
2371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 2372733 - 2372670
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
2372733 |
aaaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2372670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 2383338 - 2383401
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
2383338 |
aaaataaaggcttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2383401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 3264000 - 3264055
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
3264000 |
ggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
3264055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 6491729 - 6491674
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6491729 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6491674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 8774610 - 8774555
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| |
|
|
| T |
8774610 |
ggcttaattgcacttttggacccttatctttccaaaagttgcagttatgaacccct |
8774555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 13791888 - 13791833
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
13791888 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
13791833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 16491299 - 16491240
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
16491299 |
aataaaataaaggcttaattgcacttttggacctttatcttttcaaaagttgcggttatg |
16491240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 20224079 - 20224126
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20224079 |
gcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
20224126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 439
Target Start/End: Original strand, 31797063 - 31797118
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
31797063 |
aggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccc |
31797118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 37029241 - 37029186
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
37029241 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
37029186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 38622716 - 38622661
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
38622716 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38622661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 43677414 - 43677360
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43677414 |
ggcttaattgcacttttggac-cctatcttttcaaaagttgcggttatgaacccct |
43677360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 49227112 - 49227175
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
49227112 |
aaaataaaggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
49227175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 52149827 - 52149772
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52149827 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 8535832 - 8535774
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
8535832 |
aaaggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8535774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 8601071 - 8601013
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
8601071 |
aaaggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8601013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 20017692 - 20017642
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
20017692 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcgtttatg |
20017642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 23208297 - 23208363
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
23208297 |
aataaagtataggcttaattatacttttggactcctatcttttcaaaagttgcggttatggacccct |
23208363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 431
Target Start/End: Complemental strand, 25820874 - 25820820
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25820874 |
aaaaaaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
25820820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 378 - 440
Target Start/End: Original strand, 34988083 - 34988145
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||| |||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
34988083 |
aaataaaagcttaattatacttttggacccctatcttttcaaaagttgcggttatgaacccct |
34988145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 47113703 - 47113645
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
47113703 |
aaaggcttaattgcacttttggacccctatcttttcaaaatttgcggttatggacccct |
47113645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 14738 - 14795
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
14738 |
aaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
14795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 8770776 - 8770723
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
8770776 |
ggcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
8770723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 14460303 - 14460356
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
14460303 |
cttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
14460356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 437
Target Start/End: Original strand, 21727615 - 21727664
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacc |
437 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgaacc |
21727664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 21727926 - 21727873
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
21727926 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21727873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 34988397 - 34988344
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
34988397 |
cttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
34988344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 36139364 - 36139421
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36139364 |
aaggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
36139421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 391 - 440
Target Start/End: Complemental strand, 36139664 - 36139615
Alignment:
| Q |
391 |
attgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36139615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 40355846 - 40355903
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
40355846 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40355903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 40618729 - 40618778
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
40618729 |
aggcttaattgcacttttggacccctatatttccaaaagttgcggttatg |
40618778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 42406881 - 42406938
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
42406881 |
aaggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
42406938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 49056437 - 49056380
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
49056437 |
aggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 52363490 - 52363437
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52363490 |
cttaattgcattttttgacccctatctttccaaaagttgcggttatgaacccct |
52363437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 921752 - 921808
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
921752 |
aggcttaattacacttttgaacctctatctttccaaaagttgcggttatgaacccct |
921808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 6809067 - 6809123
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
6809067 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
6809123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 382 - 438
Target Start/End: Complemental strand, 7598922 - 7598866
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
7598922 |
aaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
7598866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 8028959 - 8029015
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
8028959 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
8029015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 9053724 - 9053660
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||||||||| || ||||||| ||||||||||||||||| |||||| |
|
|
| T |
9053724 |
aaaattaaggcttaattgcacttttggaccccctatcttttcaaaagttgcggttatggacccct |
9053660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 18589849 - 18589897
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18589849 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
18589897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20224390 - 20224334
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20224390 |
aggcttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
20224334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 20471413 - 20471469
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
20471413 |
aggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20471469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20471726 - 20471670
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20471726 |
aggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20471670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 20559811 - 20559867
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
20559811 |
aggcttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20559867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 20560124 - 20560068
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
20560124 |
aggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20560068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 22204619 - 22204571
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22204619 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
22204571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 23792780 - 23792828
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23792780 |
ggcttaattacacttttggacacctatctttccaaaagttgcggttatg |
23792828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29795008 - 29794952
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29795008 |
aggcataattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 30294870 - 30294918
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
30294870 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30294918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 37028927 - 37028983
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||| |
|
|
| T |
37028927 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
37028983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 40814887 - 40814934
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40814887 |
ggcttaattgcacttttggac-cctatctttccaaaagttgcggttatg |
40814934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 42589420 - 42589468
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
42589420 |
ggcttaattgcacttttggacttctatctttacaaaagttgcggttatg |
42589468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 43914894 - 43914838
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
43914894 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
43914838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 44846917 - 44846973
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
44846917 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
44846973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 49056123 - 49056179
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||| |||||| |
|
|
| T |
49056123 |
ggcttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 52149520 - 52149572
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
52149520 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 2371490 - 2371435
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
2371490 |
ggcttaattgcacttttggacccctatcttttaaaaagttgcggttatggacccct |
2371435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 6183295 - 6183240
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| | |||||| |
|
|
| T |
6183295 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
6183240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 9517250 - 9517305
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9517250 |
ggcttaattgctcttttggacccctatcttttcaaaagttgcggttatggacccct |
9517305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 12071641 - 12071692
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
12071641 |
aaaggcttaattacacttttggacccctatctttcaaaaagttgcggttatg |
12071692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 22075664 - 22075617
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
22075664 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 28503449 - 28503394
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |||||||| |||||| |
|
|
| T |
28503449 |
ggcttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
28503394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 49227429 - 49227374
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||| ||||||||| |||||| |
|
|
| T |
49227429 |
ggcttaattgcacttttggacccctaactttccaaaagtcgcggttatggacccct |
49227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 1480555 - 1480510
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
1480555 |
ttaattgcacttttgtacccctatctttccaaaagttgcggttatg |
1480510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 14460617 - 14460560
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||| |||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
14460617 |
aaggtttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
14460560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 20359308 - 20359263
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20359308 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatg |
20359263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 20551662 - 20551707
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20551662 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatg |
20551707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 386 - 431
Target Start/End: Original strand, 25820111 - 25820156
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
25820111 |
gcttaattgcacttttggacccctaactttccaaaagttgcggtta |
25820156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 27855563 - 27855612
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
27855563 |
ggcttaattgcacttttgaacccctatcttttcaaaagttgcggttatga |
27855612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 429
Target Start/End: Complemental strand, 33811739 - 33811694
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33811739 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggt |
33811694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 429
Target Start/End: Complemental strand, 33871209 - 33871164
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33871209 |
aggcttaattgcatttttggacccctatctttccaaaagttgcggt |
33871164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 374 - 427
Target Start/End: Original strand, 35580727 - 35580780
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||| || ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
35580727 |
aataacatgaaggcttaattgcacttttggccccctatctttccaaaagttgcg |
35580780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 45680093 - 45680146
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
45680093 |
cttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
45680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 51272993 - 51272936
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||| |||||||||||||||| |||||| |
|
|
| T |
51272993 |
aaggcttaattgcacttttagacccttatctttcaaaaagttgcggttatggacccct |
51272936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 3383963 - 3384011
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
3383963 |
aggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 4243133 - 4243185
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| |||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
4243133 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
4243185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 9517556 - 9517504
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
9517556 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
9517504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 23208620 - 23208564
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||| |||||||||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
23208620 |
aggcttagttgtacttttggacccctatctttccaaaagttgcggttacggacccct |
23208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 389 - 433
Target Start/End: Complemental strand, 23357003 - 23356959
Alignment:
| Q |
389 |
taattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatg |
23356959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 26434712 - 26434764
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| ||||||||| ||||| |
|
|
| T |
26434712 |
ttaattgcacttttgaacccctatctttccaaaagttacggttatgaccccct |
26434764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 30295184 - 30295136
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
30295184 |
aggcttaattgcacttttggacccctatctttctaaaagttgtggttat |
30295136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 40815179 - 40815131
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
40815179 |
ggcttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
40815131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 43670627 - 43670579
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
43670627 |
ggcttaattgcacatttggacccctatatttccaaaagttgcggttatg |
43670579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Complemental strand, 8029269 - 8029222
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
8029269 |
gcttaattgcacttttggatccctatctttccaaaagttgcagttatg |
8029222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 12071958 - 12071911
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12071958 |
ggcttaattgcacttttggatctctatctttccaaaagttgcggttat |
12071911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 28503127 - 28503190
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||| ||||||| ||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
28503127 |
aaaaaaaaggcttaattacacttttagacctctatcttttcaaaagttgcggttatggacccct |
28503190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 30289165 - 30289224
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||| || ||||||||||||||||| |||||||| ||||| |
|
|
| T |
30289165 |
aaaggcttaattgcacttttagaccccctatctttccaaaagttgtggttatgaccccct |
30289224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 47764091 - 47764146
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||| ||| ||||||||||||||||| |||||| |
|
|
| T |
47764091 |
ggcttaattgcacttttggacctctattttttcaaaagttgcggttatggacccct |
47764146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 13098032 - 13098086
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
13098032 |
gcttaattgcacttttggatccctatcttttaaaaagttgcggttatgaccccct |
13098086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 438
Target Start/End: Original strand, 22071166 - 22071216
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
22071166 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
22071216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 30288511 - 30288457
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
30288511 |
gcttaattgcacttttggatctctatcttttaaaaagttgcggttatgaacccct |
30288457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 387 - 433
Target Start/End: Complemental strand, 30289458 - 30289412
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |||||||| |
|
|
| T |
30289458 |
cttaattgcacttttggacccatatctttccaaaagttacggttatg |
30289412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 41585597 - 41585543
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||| |||||| |
|
|
| T |
41585597 |
gcttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
41585543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 4243441 - 4243392
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
4243441 |
aggcttaattgcacttttggatccctatctttttaaaagttgcggttatg |
4243392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 376 - 425
Target Start/End: Complemental strand, 5225674 - 5225625
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
5225674 |
taaaataaaggtttaattgcacttttggatccctatctttcctaaagttg |
5225625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 19830116 - 19830169
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| | |||||||| ||||||||||| |||| |||||| |
|
|
| T |
19830116 |
cttaattgcacttttggacccttatctttcaaaaagttgcggctatggacccct |
19830169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 387 - 432
Target Start/End: Original strand, 29704619 - 29704664
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29704619 |
cttaattgcacttttggacctctatcttttcaaaagttgcggttat |
29704664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 38622402 - 38622451
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || ||||||| |||||| |
|
|
| T |
38622402 |
aggcttaattgcacttttggacccctatcttttcagaagttgcagttatg |
38622451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 15911670 - 15911714
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
15911670 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
15911714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 398 - 433
Target Start/End: Complemental strand, 13099341 - 13099306
Alignment:
| Q |
398 |
ttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13099341 |
ttttggactcctatcttttcaaaagttgcggttatg |
13099306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 388 - 427
Target Start/End: Complemental strand, 26932923 - 26932884
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
26932923 |
ttaattgcacttttggccccctatctttccaaaagttgcg |
26932884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 32038152 - 32038105
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||| |||||| |
|
|
| T |
32038152 |
ggcttaattgcacttttggatccctatctttctaaaagttgtggttat |
32038105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 389 - 440
Target Start/End: Complemental strand, 40356158 - 40356107
Alignment:
| Q |
389 |
taattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||| ||||||| |||||| |
|
|
| T |
40356158 |
taattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
40356107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 50591556 - 50591599
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
50591556 |
aggcttaattgcacttttggccccttatctttccaaaagttgcg |
50591599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 423
Target Start/End: Complemental strand, 866457 - 866419
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
866457 |
ggcttaattgcacttttggatccctatctttccaaaagt |
866419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 7159507 - 7159549
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
7159507 |
ggcttaattgcacttttgaccccctatctttccaaaagttgcg |
7159549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 425
Target Start/End: Original strand, 7489511 - 7489549
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
7489511 |
cttaattgcacttttggccccctatctttccaaaagttg |
7489549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 7764495 - 7764453
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
7764495 |
aggcttaattgcacttttggccccctatcttttcaaaagttgc |
7764453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 438
Target Start/End: Original strand, 9332906 - 9332956
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
9332906 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9332956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 388 - 438
Target Start/End: Original strand, 9356679 - 9356729
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
9356679 |
ttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 26932575 - 26932624
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| |||||||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
26932575 |
aaaaaaaaggcttaattgcactttt-gacccctatcttttcaaaagttgcg |
26932624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 423
Target Start/End: Original strand, 33777166 - 33777204
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
33777166 |
ggcttaattgcacttttggacccctatctttctaaaagt |
33777204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 384 - 426
Target Start/End: Complemental strand, 46351537 - 46351495
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
46351537 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgc |
46351495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 427
Target Start/End: Original strand, 52201362 - 52201407
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
52201362 |
taaaggcttaattgcacttttgg-cccctatcttttcaaaagttgcg |
52201407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 382 - 427
Target Start/End: Original strand, 1712367 - 1712412
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
1712367 |
aaaggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
1712412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 20017384 - 20017429
Alignment:
| Q |
388 |
ttaattgcacttttggactcc-tatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||| ||||||| |
|
|
| T |
20017384 |
ttaattgcacttttggaccccctatctttccaaaagttacggttat |
20017429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 421
Target Start/End: Complemental strand, 20288061 - 20288024
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaa |
421 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
20288061 |
aggcttaattgcacttttggacccatatctttccaaaa |
20288024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 42589715 - 42589667
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
42589715 |
aggcttaattacacttttggacccctatcttttc-aaagttgcggttatg |
42589667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 45664162 - 45664207
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
45664162 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatg |
45664207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 52233726 - 52233677
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||| ||||||| ||||| ||| ||||||||||||||||| |
|
|
| T |
52233726 |
aggcttaattgcatttttggatccctatattttcaaaagttgcggttatg |
52233677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 8535528 - 8535576
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||| |||||||| ||||||| |
|
|
| T |
8535528 |
ggcttaactgcacttttggacccctatttttctaaaagttgtggttatg |
8535576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 8600767 - 8600815
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||||||||| ||||| |||| |||||||| ||||||| |
|
|
| T |
8600767 |
ggcttaactgcacttttggacccctatttttctaaaagttgtggttatg |
8600815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 18590143 - 18590095
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| ||||||| |
|
|
| T |
18590143 |
ggcttaattgcacttttggatccctatctttttaaaagttgtggttatg |
18590095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 424
Target Start/End: Original strand, 36196820 - 36196856
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
36196820 |
ttaattgcacttttggcctcctatctttctaaaagtt |
36196856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 41585285 - 41585333
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
41585285 |
ggcttaattgcatttttggatctctatcttttcaaaagttgcggttatg |
41585333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 392 - 440
Target Start/End: Complemental strand, 45680396 - 45680348
Alignment:
| Q |
392 |
ttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
45680396 |
ttgcacttttggatccctattttttcaaaagttgcggttatggacccct |
45680348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 238948 - 238882
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | |||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
238948 |
aataaaaaataggcttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
238882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 238621 - 238677
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
238621 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 51; Significance: 5e-20; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 401022 - 400964
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
401022 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 400703 - 400752
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
400703 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
400752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 5e-20; HSPs: 119)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 22279500 - 22279554
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
22279500 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
22279554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 7391483 - 7391540
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
7391483 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7391540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 375 - 440
Target Start/End: Complemental strand, 30966015 - 30965950
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
30966015 |
ataaaaaaaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
30965950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 387 - 440
Target Start/End: Complemental strand, 31741082 - 31741029
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31741082 |
cttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
31741029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 4405555 - 4405499
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
4405555 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4405499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 6261691 - 6261635
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6261691 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 10893881 - 10893937
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10893881 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
10893937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 11213497 - 11213441
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
11213497 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11213441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 13042407 - 13042463
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
13042407 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 381 - 433
Target Start/End: Original strand, 15272994 - 15273046
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15272994 |
taaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
15273046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 23291255 - 23291311
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
23291255 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23291311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 6261381 - 6261436
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6261381 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 377 - 440
Target Start/End: Complemental strand, 31833587 - 31833524
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||| ||||||||||| |||||| |
|
|
| T |
31833587 |
aaaaaaaaggcttaattgcacttttggacccctatctttccaaaaattgcggttatggacccct |
31833524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 1815292 - 1815234
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
1815292 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
1815234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 432
Target Start/End: Original strand, 1896895 - 1896945
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1896895 |
aaaggcttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 11745996 - 11746046
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11745996 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
11746046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 14996998 - 14997064
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
14996998 |
aataatatataggcttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14997064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 20080116 - 20080166
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20080116 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20080166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 380 - 433
Target Start/End: Complemental strand, 2565397 - 2565344
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
2565397 |
ataaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2565344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 26716685 - 26716636
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26716685 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26716636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 27765256 - 27765313
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
27765256 |
aaggattaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27765313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 31951515 - 31951466
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31951515 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
31951466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 2100379 - 2100435
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
2100379 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatgaatccct |
2100435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 7391791 - 7391735
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
7391791 |
aggcttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
7391735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 11322339 - 11322283
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11322339 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11322283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 11614897 - 11614953
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
11614897 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
11614953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 13042721 - 13042673
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13042721 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
13042673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 376 - 440
Target Start/End: Original strand, 13439868 - 13439932
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||| ||||||||||||||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
13439868 |
taaattaaaggattaattgcacttttgaactcctatctttccaaaagttgcgtttatggacccct |
13439932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 13440190 - 13440134
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| | |||||| |
|
|
| T |
13440190 |
aggcttaattgcacttttggactcttatctttccaaaagttgcggttacggacccct |
13440134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 15149727 - 15149775
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15149727 |
ggcttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
15149775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 25749955 - 25750003
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25749955 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25750003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 27223623 - 27223567
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
27223623 |
aggcttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
27223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 29697157 - 29697101
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
29697157 |
aggcttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29697101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 1814976 - 1815031
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1814976 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1815031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 2565075 - 2565126
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
2565075 |
aaaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2565126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 10977658 - 10977713
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
10977658 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
10977713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 381 - 440
Target Start/End: Original strand, 12256760 - 12256819
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
12256760 |
taaaggcgtaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
12256819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 16765041 - 16765096
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16765041 |
ggcttaattgtacttttggacccctatctttccaaaagttgcggttatgcacccct |
16765096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 23883401 - 23883346
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
23883401 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
23883346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 31740761 - 31740824
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
31740761 |
aaaaaaaaggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
31740824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 5606613 - 5606555
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
5606613 |
aaaggcttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
5606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 384 - 438
Target Start/End: Complemental strand, 16735879 - 16735825
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
16735879 |
aggcttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
16735825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 28563636 - 28563578
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
28563636 |
aaaggcttaattgcacttttggacctctatctttcaaaaagttgcggttatggacccct |
28563578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 30239520 - 30239462
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||| |||||| |||||| |
|
|
| T |
30239520 |
aaaggcttaattgcacttttagacccctatctttccaaaagttgcagttatggacccct |
30239462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 386 - 436
Target Start/End: Original strand, 31833267 - 31833317
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaac |
436 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
31833267 |
gcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaac |
31833317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 1897194 - 1897137
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||||||||||| ||||| |
|
|
| T |
1897194 |
aaggcttaattgcatttttgaacccctatctttccaaaagttgcggttatgaccccct |
1897137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 3194750 - 3194701
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
3194750 |
aggcttaattgcacttttggactcatatctttctaaaagttgcggttatg |
3194701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 9703859 - 9703802
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
9703859 |
aaggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 375 - 432
Target Start/End: Original strand, 11277616 - 11277673
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||| |||||||||||||||| |
|
|
| T |
11277616 |
ataaaattaaggcttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 18683325 - 18683268
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
18683325 |
aaggcttaatttcacttttggacccctatttttccaaaagttgcggttatggacccct |
18683268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 383 - 432
Target Start/End: Original strand, 20630350 - 20630399
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
20630350 |
aaggcttaattgcacttatggacccctatctttccaaaagttgcggttat |
20630399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 2100695 - 2100639
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
2100695 |
aggcttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
2100639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 3185471 - 3185415
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
3185471 |
aggcttaattgcacttttggtcccctatcttttcaaaagttgcggttatggacccct |
3185415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 5606295 - 5606351
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
5606295 |
aggcttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
5606351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 10894183 - 10894135
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10894183 |
ggcttaattgcacttttggacctctatctttccaaaagttgcggttatg |
10894135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 11746292 - 11746244
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
11746292 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
11746244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 12257078 - 12257022
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
12257078 |
aggcttaattgcacttttggacctttatctttccaaaagttgcggttatggacccct |
12257022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 432
Target Start/End: Complemental strand, 14997323 - 14997275
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
14997323 |
aggcttaattgcacttttggacccctatctttgcaaaagttgcggttat |
14997275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 380 - 440
Target Start/End: Complemental strand, 15711954 - 15711894
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
15711954 |
ataaaggcttaattgcacttttcgacccctatctttttaaaagttgcggttatggacccct |
15711894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 21003367 - 21003423
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| | |||||| |
|
|
| T |
21003367 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
21003423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 381 - 425
Target Start/End: Complemental strand, 23585295 - 23585251
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
23585295 |
taaaggcttaattgcacttttggacccctatctttccaaaagttg |
23585251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 28563326 - 28563382
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
28563326 |
aggcttaattgcacttttggacccctacctttctaaaagttgcggttatggacccct |
28563382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 29696847 - 29696903
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
29696847 |
aggcttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
29696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 30965690 - 30965746
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||| |||||| |||||| |
|
|
| T |
30965690 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
30965746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 375 - 439
Target Start/End: Original strand, 31951195 - 31951259
Alignment:
| Q |
375 |
ataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
31951195 |
ataaaataaaggtttaattgcatttttggacccctatctttttaaaagttgcggttatggacccc |
31951259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 34705689 - 34705641
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
34705689 |
ggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
34705641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 433
Target Start/End: Original strand, 3534795 - 3534846
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3534795 |
aaagacttaattacacttttggacccctatctttccaaaagttgcggttatg |
3534846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 20630662 - 20630607
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
20630662 |
ggcttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 23883089 - 23883144
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||||||| ||||||||||||||||| |||||| |
|
|
| T |
23883089 |
ggcttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
23883144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 28930777 - 28930730
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
28930777 |
ggcttaattgcacttttggacccctatcttttcaaaagttgcggttat |
28930730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 384 - 431
Target Start/End: Original strand, 28931948 - 28931995
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
28931948 |
aggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 387 - 433
Target Start/End: Original strand, 3195718 - 3195764
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
3195718 |
cttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
3195764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 9067748 - 9067690
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||| || ||||||| |||||||||||||||||| ||||| |
|
|
| T |
9067748 |
aaaggtttaattgcacttttggattcttatcttttcaaaagttgcggttatgaccccct |
9067690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 388 - 438
Target Start/End: Complemental strand, 11277927 - 11277877
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||| |||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
11277927 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatgaaccc |
11277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 15150044 - 15149986
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
15150044 |
aaaggtttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
15149986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 383 - 433
Target Start/End: Complemental strand, 26171522 - 26171472
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
26171522 |
aaggcttaattgcacttttggacccctatctttccaaaacttgcgattatg |
26171472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 28932950 - 28932904
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
28932950 |
ggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 28960220 - 28960270
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
28960220 |
aaaataaaggcttaattgtacttttggccccctatctttccaaaagttgcg |
28960270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 3535089 - 3535044
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
3535089 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
3535044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 15273289 - 15273244
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
15273289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
15273244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 377 - 438
Target Start/End: Original strand, 28930456 - 28930517
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||| ||||||||||||||||| |||| |
|
|
| T |
28930456 |
aaaaaaaaagcttaattgcacttttggacctctatcttttcaaaagttgcggttatggaccc |
28930517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 30818530 - 30818473
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
30818530 |
aaggcttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
30818473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 11307391 - 11307347
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
11307391 |
aaggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
11307347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 11445979 - 11446031
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
11445979 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
11446031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 379 - 427
Target Start/End: Complemental strand, 12730655 - 12730607
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
12730655 |
aatataggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
12730607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 17966151 - 17966096
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcc-tatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
17966151 |
ggcttaattgcacttttggaccccctatctttccaaa-gttgcggttatgaacccct |
17966096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 423
Target Start/End: Complemental strand, 9126689 - 9126650
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagt |
423 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9126689 |
aggcttaattgcacttttggacccctatctttccaaaagt |
9126650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 17965831 - 17965894
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||| ||||||||||||||||| ||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
17965831 |
aaaaaaaaggtttaattgcacttttggatccctatcttttcaaaagttggggttatggacccct |
17965894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 18683012 - 18683067
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||| ||||||| |||||| |
|
|
| T |
18683012 |
ggcttaattgcacttttggacctctatcttttcaaaagttgtggttatggacccct |
18683067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 23349760 - 23349803
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23349760 |
aggcttaattgcacttttggcttcctatctttccaaaagttgcg |
23349803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 386 - 433
Target Start/End: Original strand, 30818219 - 30818266
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
30818219 |
gcttgattgcacttttggacccctatcttttcaaaagttgcggttatg |
30818266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 377 - 424
Target Start/End: Original strand, 33274224 - 33274271
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
33274224 |
aaaataaaggcttaattgcacttttggccccctatcttttcaaaagtt |
33274271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 390 - 440
Target Start/End: Original strand, 3185238 - 3185288
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||| |||||||| ||||| |
|
|
| T |
3185238 |
aattgcactttaggacccctatctttccaaaagttgaggttatgaccccct |
3185288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 378 - 432
Target Start/End: Complemental strand, 10255840 - 10255786
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
10255840 |
aaataaaggtttaattgcacttttggacccctatctttttaaaagttgcagttat |
10255786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 438
Target Start/End: Complemental strand, 10977968 - 10977918
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||||||| |||||||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
10977968 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
10977918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 15711637 - 15711683
Alignment:
| Q |
388 |
ttaattgcacttttggac-tcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
15711637 |
ttaattgcacttttggacctcctatcttttcaaaagttgcggttatg |
15711683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 24418486 - 24418528
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
24418486 |
ggcttaattgcacttttggcctcctatcttttcaaaagttgcg |
24418528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 33265078 - 33265128
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||| |||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
33265078 |
aaaataaaggtttaattgcacttttggccccctatctttctaaaagttgcg |
33265128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 11321900 - 11321957
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||| |||||||| ||||||| |||||| |
|
|
| T |
11321900 |
aaggcttaattgcacttttggacccctatttttttaaaagttgtggttatggacccct |
11321957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 20080413 - 20080364
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
20080413 |
aggcttaattgtacttttggacccctatctttgtaaaagttgcggttatg |
20080364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 377 - 430
Target Start/End: Original strand, 34705368 - 34705421
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtt |
430 |
Q |
| |
|
|||| ||||||||||||||| |||||||| ||||| ||| |||||||||||||| |
|
|
| T |
34705368 |
aaaaaaaaggcttaattgcatttttggacccctatattttcaaaagttgcggtt |
34705421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 427
Target Start/End: Complemental strand, 378557 - 378510
Alignment:
| Q |
379 |
aataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||| |||||| |
|
|
| T |
378557 |
aataaaggcttaattgcactttt-gacccctatctttccaaatgttgcg |
378510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Original strand, 4037036 - 4037080
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
4037036 |
aaggcttaattgcacttttggccccctatcttttcaaaagttgcg |
4037080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 11615213 - 11615157
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||| |||||| |
|
|
| T |
11615213 |
aggcttaattgcacttttgggtccctatctttttaaaagttgcggttatggacccct |
11615157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 16765351 - 16765296
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | ||||||| ||||||| |||||| |
|
|
| T |
16765351 |
aggcttaattgcacttttggacccctatctttac-aaagttgaggttatggacccct |
16765296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 377 - 433
Target Start/End: Complemental strand, 22279819 - 22279763
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||| ||||| ||||||||||||||| || ||||||||| ||||| ||||||||||| |
|
|
| T |
22279819 |
aaaaaaaagggttaattgcacttttgaacccctatcttttcaaaaattgcggttatg |
22279763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 26479356 - 26479308
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
26479356 |
ggcttaattgcacttttggatccctatttttccaaaagttgcagttatg |
26479308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 381 - 424
Target Start/End: Original strand, 9951883 - 9951926
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
9951883 |
taaaggcttaattgcacttttggccacctatcttttcaaaagtt |
9951926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 27771527 - 27771472
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||| ||||||||||| | ||||||| |||||||||||||||| |||||| |
|
|
| T |
27771527 |
ggcttaattacacttttggacccttatctttttaaaagttgcggttatggacccct |
27771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 381 - 427
Target Start/End: Original strand, 14168572 - 14168618
Alignment:
| Q |
381 |
taaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
14168572 |
taaaggcttaattgcacttttggccctctatcttttcaaaagttgcg |
14168618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 14169034 - 14168976
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||| ||||| || ||| ||||| |
|
|
| T |
14169034 |
aaaggcttaattgcacttttggccccctatcttttcaaaatttgcgattttgaccccct |
14168976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 383 - 425
Target Start/End: Complemental strand, 21009058 - 21009016
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttg |
425 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
21009058 |
aaggcttaattacacttttggacctctatctttccaaaagttg |
21009016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 427
Target Start/End: Original strand, 24119492 - 24119534
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
24119492 |
ggcttaattgcacttttggcctcctattttttcaaaagttgcg |
24119534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 438
Target Start/End: Complemental strand, 3196025 - 3195972
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||| ||||||| |||| |
|
|
| T |
3196025 |
ggcttaattgcacttttggatccttatcttttcaaaagttgtggttatggaccc |
3195972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 426
Target Start/End: Original strand, 6324202 - 6324243
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||| |
|
|
| T |
6324202 |
ggcttaattgcacttttggccccctatcttttcaaaagttgc |
6324243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 26479192 - 26479241
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
26479192 |
aggcttaattatacttttggacccttatctttccaaaagttgcgattatg |
26479241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 378 - 427
Target Start/End: Original strand, 32591589 - 32591638
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
32591589 |
aaataaatgcttaattgcacttttggcaccctatcttttcaaaagttgcg |
32591638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 7324658 - 7324702
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
7324658 |
ttaattgcatttttggatccctatcttttcaaaagttgcggttat |
7324702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 21008726 - 21008782
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||| ||| ||||||| ||||||||| |||||||||||||| |
|
|
| T |
21008726 |
aggcttaattgcatttttagacctttatcttttcaaaagttgtggttatgaacccct |
21008782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 376 - 433
Target Start/End: Original strand, 7712 - 7769
Alignment:
| Q |
376 |
taaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7712 |
taaaaaaaaggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 386 - 440
Target Start/End: Complemental strand, 8033 - 7979
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
8033 |
gcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 50; Significance: 2e-19; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 10943 - 10886
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
10943 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Complemental strand, 16233 - 16176
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
16233 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 10627 - 10683
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10627 |
aggcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
10683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 15917 - 15973
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
15917 |
aggcttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
15973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 50; Significance: 2e-19; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 20593 - 20650
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
20593 |
aaggcttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
20650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 378 - 438
Target Start/End: Complemental strand, 20934 - 20874
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaaccc |
438 |
Q |
| |
|
||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
20934 |
aaatataggcttatttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
20874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 12050 - 12102
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
12050 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 383 - 440
Target Start/End: Original strand, 29648 - 29705
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
29648 |
aaggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 378 - 440
Target Start/End: Complemental strand, 29971 - 29909
Alignment:
| Q |
378 |
aaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| |
|
|
| T |
29971 |
aaatcaaggcttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
29909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 147 - 91
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
147 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
91 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Original strand, 6867 - 6923
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
6867 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 81616 - 81560
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
81616 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
81560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 386 - 440
Target Start/End: Original strand, 81306 - 81360
Alignment:
| Q |
386 |
gcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
81306 |
gcttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
81360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 4835 - 4785
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
4835 |
aggcttaattgcacttttggacccctatctttccaaaagttgcggttatga |
4785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 387 - 433
Target Start/End: Original strand, 4543 - 4589
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||| | ||||||| ||||||||||| ||||| |
|
|
| T |
4543 |
cttaattgcacttttggacccttatcttttcaaaagttgcgtttatg |
4589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 374 - 440
Target Start/End: Complemental strand, 1508 - 1442
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | ||| |||||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1508 |
aataaaaaataggtttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
1442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Original strand, 1187 - 1239
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
1187 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 382 - 440
Target Start/End: Complemental strand, 20942 - 20884
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
20942 |
aaaggcttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
20884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 385 - 440
Target Start/End: Original strand, 20622 - 20681
Alignment:
| Q |
385 |
ggcttaattgcacttttggac----tcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
20622 |
ggcttaattgcacttttggacccctccctatcttttcaaaagttgcggttatggacccct |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 184 - 128
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||| |||||| |
|
|
| T |
184 |
aggcttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 16067 - 16019
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16067 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 15777 - 15822
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||| | |||||||| |||||||||||||||| |
|
|
| T |
15777 |
ttaattgcacttttggatccttatctttctaaaagttgcggttatg |
15822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 21360 - 21312
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21360 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 21066 - 21114
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||| ||||| |
|
|
| T |
21066 |
ggcttaattgcacttttggatccctatctttccaaaatttgcgattatg |
21114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 22295 - 22343
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22295 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
22343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 22589 - 22541
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22589 |
ggcttaattgcacttttggacccctatctttccaaaagttgcggttatg |
22541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 45; Significance: 2e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 139484 - 139432
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
139484 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
139432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 382 - 440
Target Start/End: Original strand, 139172 - 139230
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
139172 |
aaaggtttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
139230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 45; Significance: 2e-16; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 79301 - 79245
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
79301 |
aggcttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
79245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 382 - 433
Target Start/End: Complemental strand, 12974 - 12923
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
12974 |
aaaggcttaattgcacttttggacccctatctttctaaaagttgcggttatg |
12923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 383 - 433
Target Start/End: Original strand, 78988 - 79038
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
78988 |
aaggcttaattgcacttttggacccctatctttccaaaagttgtggttatg |
79038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 384 - 439
Target Start/End: Original strand, 818 - 873
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccc |
439 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
818 |
aggcttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccc |
873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 44; Significance: 7e-16; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 377 - 440
Target Start/End: Original strand, 75102 - 75165
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||| |||||||||||||| |||||| |||||| |
|
|
| T |
75102 |
aaaaaaaaggcttaattgcacttttggacccctatttttccaaaagttgccgttatggacccct |
75165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Complemental strand, 75385 - 75340
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
75385 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
75340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 431
Target Start/End: Original strand, 21830 - 21884
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggtta |
431 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
21830 |
aaaaaaaaggcttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 380 - 433
Target Start/End: Complemental strand, 1653 - 1601
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1653 |
ataaaggtttaattgcacttttggac-cctatctttccaaaagttgcggttatg |
1601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 382 - 429
Target Start/End: Original strand, 1352 - 1399
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
1352 |
aaaggcttaattgcacttttggatccctatcttttcaaaagttgcggt |
1399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 3708 - 3753
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3708 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
3753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 440
Target Start/End: Original strand, 2646 - 2699
Alignment:
| Q |
387 |
cttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||| |||||| |
|
|
| T |
2646 |
cttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 440
Target Start/End: Complemental strand, 2958 - 2903
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||||||||||| | ||| |||| |||||||| ||||||| |||||| |
|
|
| T |
2958 |
ggcttaattgcacttttggacccttatttttctaaaagttggggttatggacccct |
2903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 384 - 440
Target Start/End: Complemental strand, 10875 - 10819
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| ||||||||||||||||| |||||| |
|
|
| T |
10875 |
aggcttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
10819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 382 - 429
Target Start/End: Complemental strand, 21165 - 21118
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcggt |
429 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
21165 |
aaaggcttaattgcatttttggacccctatctttccaaaagttgcggt |
21118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 383 - 432
Target Start/End: Original strand, 20866 - 20915
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcggttat |
432 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
20866 |
aaggcttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 382 - 426
Target Start/End: Original strand, 10556 - 10600
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
10556 |
aaaggcttaattgcacttttggacccctatcttttccaaagttgc |
10600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 377 - 433
Target Start/End: Original strand, 26255 - 26311
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
26255 |
aaaataatcgcttaattgcacttttgaactcctatcttttcaaaagttgcggttatg |
26311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 390 - 433
Target Start/End: Complemental strand, 26555 - 26512
Alignment:
| Q |
390 |
aattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatg |
26512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 388 - 440
Target Start/End: Complemental strand, 14615 - 14563
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
14615 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 3772 - 3830
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3772 |
aataaaaataaggcctaattgcacttttggac-cctatctttccaaaagttgcggttatg |
3830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 9024 - 8974
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcggttatga |
434 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
9024 |
aggcttaattgcatttttggacccctatctttccaaaagttgtggttatga |
8974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 374 - 440
Target Start/End: Original strand, 752 - 818
Alignment:
| Q |
374 |
aataaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
440 |
Q |
| |
|
||||||| | ||||||||||||| |||| ||| ||||||||||||||||||||||||| | |||||| |
|
|
| T |
752 |
aataaaacataggcttaattgcatttttagacccctatctttccaaaagttgcggttacggacccct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 122646 - 122601
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
122646 |
aaaggcttaattgcacttttggccccctatctttccaaaagttgcg |
122601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 388 - 433
Target Start/End: Original strand, 16522 - 16567
Alignment:
| Q |
388 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
433 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
16522 |
ttaattgctcttttggattcctatcttttcaaaagttgcggttatg |
16567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 385 - 426
Target Start/End: Original strand, 31979 - 32020
Alignment:
| Q |
385 |
ggcttaattgcacttttggactcctatctttccaaaagttgc |
426 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31979 |
ggcttaattgcacttttggccccctatctttccaaaagttgc |
32020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 382 - 427
Target Start/End: Complemental strand, 32326 - 32281
Alignment:
| Q |
382 |
aaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||| |||||||| | ||||||||||||||||||||| |
|
|
| T |
32326 |
aaaggcttaattgtacttttggccccctatctttccaaaagttgcg |
32281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1301 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold1301
Description:
Target: scaffold1301; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 383 - 427
Target Start/End: Complemental strand, 1363 - 1319
Alignment:
| Q |
383 |
aaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
||||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
1363 |
aaggcttaattgcacttttggccccttatctttccaaaagttgcg |
1319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0097 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0097
Description:
Target: scaffold0097; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 380 - 424
Target Start/End: Complemental strand, 47191 - 47147
Alignment:
| Q |
380 |
ataaaggcttaattgcacttttggactcctatctttccaaaagtt |
424 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
47191 |
ataaaggcttaactgcacttttggccccctatctttccaaaagtt |
47147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0236 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 427
Target Start/End: Original strand, 22816 - 22859
Alignment:
| Q |
384 |
aggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
22816 |
aggcttaattgcacttttggccccttatctttccaaaagttgcg |
22859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2010 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold2010
Description:
Target: scaffold2010; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 377 - 427
Target Start/End: Original strand, 485 - 535
Alignment:
| Q |
377 |
aaaataaaggcttaattgcacttttggactcctatctttccaaaagttgcg |
427 |
Q |
| |
|
|||| ||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
485 |
aaaaaaaaggcttaattgcacttttgaccccctatcttttcaaaagttgcg |
535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University