View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3401_low_5 (Length: 243)
Name: NF3401_low_5
Description: NF3401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3401_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 1709165 - 1709066
Alignment:
| Q |
18 |
agaaagaagctgagaaagagcacgtccgatggcggtgtcgtttcgcgtatcgtgtgtgaagttattctgcgttttgatggcggagtgttcgtagttttca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1709165 |
agaaagaagctgagaaagagcacgtccgatggcggtgtcgtttcgcgtatcgtgtgtgaagttattctgcgttttgatggcggagtgttcgtagttttca |
1709066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 184 - 221
Target Start/End: Complemental strand, 1708999 - 1708962
Alignment:
| Q |
184 |
gtttggatgagtttgtagttgacagagaaggagaggaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1708999 |
gtttggatgagtttgtagttgacagagaaggagaggaa |
1708962 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University