View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3402_high_1 (Length: 338)

Name: NF3402_high_1
Description: NF3402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3402_high_1
NF3402_high_1
[»] chr6 (1 HSPs)
chr6 (232-296)||(28084111-28084175)


Alignment Details
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 232 - 296
Target Start/End: Complemental strand, 28084175 - 28084111
Alignment:
232 gaattgtaattgagtaaggaacaagtgaaaattacaaaaagttaaagaacaatcaacaataatga 296  Q
    |||||| | |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||    
28084175 gaattgcagttgagtaaggaacaagtgaaaattacaaaaagctaaagaacaagcaacaataatga 28084111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University