View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3402_low_2 (Length: 338)
Name: NF3402_low_2
Description: NF3402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3402_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 232 - 296
Target Start/End: Complemental strand, 28084175 - 28084111
Alignment:
| Q |
232 |
gaattgtaattgagtaaggaacaagtgaaaattacaaaaagttaaagaacaatcaacaataatga |
296 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
28084175 |
gaattgcagttgagtaaggaacaagtgaaaattacaaaaagctaaagaacaagcaacaataatga |
28084111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University