View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3403_high_20 (Length: 227)
Name: NF3403_high_20
Description: NF3403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3403_high_20 |
 |  |
|
| [»] scaffold0059 (1 HSPs) |
 |  |  |
|
| [»] scaffold0554 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0059 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 7 - 109
Target Start/End: Original strand, 62484 - 62586
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaatt |
106 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| | | || ||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
62484 |
ctttcttcatcactcttggatctcttaccaactctgccattgcccaaactacgctcaaagctgatgtatcacctccagcaccaaacatgtcctgaaaatt |
62583 |
T |
 |
| Q |
107 |
aaa |
109 |
Q |
| |
|
||| |
|
|
| T |
62584 |
aaa |
62586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 15885631 - 15885529
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaatt |
106 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||||||||||| | || |||||||| |||||| |||||||||||||||||||| | |
|
|
| T |
15885631 |
ctttcttcatcactctttcatcccttaccaactctgccattgcccaaactatggtggtactcgatgtatctcctccagcaccaaacatgtcctgaaaagt |
15885532 |
T |
 |
| Q |
107 |
aaa |
109 |
Q |
| |
|
||| |
|
|
| T |
15885531 |
aaa |
15885529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 12637329 - 12637426
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaa |
104 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| |||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
12637329 |
ctttcttcatcactcttggatcccttactaactctgccattgcccaaactatggtagtggatgatgtttcacctccagcaccaatgatgtcctgaaaa |
12637426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 12610236 - 12610319
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaa |
90 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| ||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
12610236 |
ctttcttcatcactcttttatcccttaccaactctgacattgcccaaactatagtagaagctgatgtatcacctccagcaccaa |
12610319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 21780144 - 21780241
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaa |
104 |
Q |
| |
|
|||||||||| | |||||||||| |||||| ||| ||||||||||| ||||||| ||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
21780144 |
ctttcttcattattcttggatcccttaccatttctaccattgcccaatctatggtgcttgctgatgtctcacctccagcaccaaacatgtcctgaaaa |
21780241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 23024603 - 23024698
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaa |
102 |
Q |
| |
|
|||||||||| | |||||||| |||||||| ||||||||||||||| ||||||| ||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
23024603 |
ctttcttcattattcttggattctttaccatttctgccattgcccaatctatggtgcttgctgatgtctcacctccagcaccaaaaatgtcctgaa |
23024698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 102
Target Start/End: Original strand, 23149089 - 23149184
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaa |
102 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |||| ||||||||||| ||||||| ||||||| || |||||| ||||||| |||||||||| |
|
|
| T |
23149089 |
ctttcttcattattcttggatcctttaccatctctaccattgcccaatctatggtgcttgctgatgtctcgcctccagcaccaaaaatgtcctgaa |
23149184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 104
Target Start/End: Original strand, 23036501 - 23036598
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaa |
104 |
Q |
| |
|
|||||||||| | |||||||| | |||||| ||||||||||||||| ||||||| ||||||| ||||||||| ||||||| |||||||||||| |
|
|
| T |
23036501 |
ctttcttcattattcttggattccttaccatttctgccattgcccaatctatggtgcttgctgatgtctcacctccagcaccaaaaatgtcctgaaaa |
23036598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 7 - 100
Target Start/End: Original strand, 23146251 - 23146344
Alignment:
| Q |
7 |
ctttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctg |
100 |
Q |
| |
|
|||||||||| | |||||||||||||||||| ||| ||||||||||| ||||||| ||||||| ||||||||| || |||| |||||||| |
|
|
| T |
23146251 |
ctttcttcatgattcttggatcctttaccaattctaccattgcccaatctatggtgcttgctgatgtctcacctccagcagcaaaaatgtcctg |
23146344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 5 - 102
Target Start/End: Original strand, 23140375 - 23140472
Alignment:
| Q |
5 |
cactttcttcatcactcttggatcctttaccaactctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaa |
102 |
Q |
| |
|
|||||||||||| | |||||||||| ||| || ||| ||||||||||| ||||||| ||||||| ||||||||| ||||||| |||||||||| |
|
|
| T |
23140375 |
cactttcttcattattcttggatcccttatcatttctaccattgcccaatctatggtgcttgctgatgtctcacctccagcaccaaaaatgtcctgaa |
23140472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 38 - 104
Target Start/End: Complemental strand, 22916509 - 22916443
Alignment:
| Q |
38 |
ctctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaa |
104 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||| |||| |||||| ||| |||| |||| |||| |
|
|
| T |
22916509 |
ctctgccattgcccataatatggtagaagctgatgtctcacttccacctccatacatatccttaaaa |
22916443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0554 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0554
Description:
Target: scaffold0554; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 39 - 104
Target Start/End: Complemental strand, 6391 - 6326
Alignment:
| Q |
39 |
tctgccattgcccaaactatggtagaacctgatgtatcacctccaccaccaaacatgtcctgaaaa |
104 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
6391 |
tctgccattgcccaatctatggtggttgctgatgtatcacctccagcaccaaaaatgtcctaaaaa |
6326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University