View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3403_high_21 (Length: 225)

Name: NF3403_high_21
Description: NF3403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3403_high_21
NF3403_high_21
[»] chr2 (1 HSPs)
chr2 (23-206)||(6281572-6281755)


Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 23 - 206
Target Start/End: Original strand, 6281572 - 6281755
Alignment:
23 tctgcccccactttggccattgacaaccaccactttgaataatggtagccactacttcaactacaccaaccaccaacgtgaccatcaatcatcggcctga 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6281572 tctgcccccactttggccattgacaaccaccactttgaataatggtagccactacttcaactacaccaaccaccaacgtgaccatcaatcatcggcctga 6281671  T
123 ccaatgtcgatcacccatccatccannnnnnnatcaccaattctactaccacgaacaaccaccccgactaccactttgactaac 206  Q
    |||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||    
6281672 ccaatgtcgatcacccatccatccatttttttatcaccaattctactaccacgaacaaccaccccgactaccactttgactaac 6281755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University