View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3403_low_22 (Length: 225)
Name: NF3403_low_22
Description: NF3403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3403_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 23 - 206
Target Start/End: Original strand, 6281572 - 6281755
Alignment:
| Q |
23 |
tctgcccccactttggccattgacaaccaccactttgaataatggtagccactacttcaactacaccaaccaccaacgtgaccatcaatcatcggcctga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6281572 |
tctgcccccactttggccattgacaaccaccactttgaataatggtagccactacttcaactacaccaaccaccaacgtgaccatcaatcatcggcctga |
6281671 |
T |
|
| Q |
123 |
ccaatgtcgatcacccatccatccannnnnnnatcaccaattctactaccacgaacaaccaccccgactaccactttgactaac |
206 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6281672 |
ccaatgtcgatcacccatccatccatttttttatcaccaattctactaccacgaacaaccaccccgactaccactttgactaac |
6281755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University