View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3404_high_1 (Length: 331)
Name: NF3404_high_1
Description: NF3404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3404_high_1 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 28 - 331
Target Start/End: Complemental strand, 30688536 - 30688233
Alignment:
| Q |
28 |
cccaacttttgctccatacaaaatcagttctaacctacaactgcgcagatggagctgtataatagtatggtaaggaaagaaggtagtgaaggtgagcagg |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
30688536 |
cccagcttttgctccatacaaaatcagttctaacctacaactgcgcagatggagctgtataatagtatggtaaggaaagaaggtggtgaaggtgagcagg |
30688437 |
T |
 |
| Q |
128 |
aagctaagaaggcctatagagctgcaaggaaggatagtgacggtgctttggaggtcgctattaatgacaaggtttcttcagcacttgttgacaaggtaaa |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30688436 |
aagctaagaaggcctatagagctgcaaggaaggatagtgacggtgctttggaggtcgctattagtgacaaggtttcttcagcacttgttgacaaggtaaa |
30688337 |
T |
 |
| Q |
228 |
cttatgaccctctacctctagtttttatttgatgccatttaataattgtaaaataaaaaagaaatcagattacctgttaatcattagctgaatgcctgga |
327 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
30688336 |
cttatgaccctctacctctagtttttatttgatgccatttaataattgtaaaacaaaaaagaaatcagattatctgctaatcattagctgaatgcctgga |
30688237 |
T |
 |
| Q |
328 |
ttat |
331 |
Q |
| |
|
|||| |
|
|
| T |
30688236 |
ttat |
30688233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University