View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3406_low_6 (Length: 274)
Name: NF3406_low_6
Description: NF3406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3406_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 248
Target Start/End: Complemental strand, 54219170 - 54218942
Alignment:
| Q |
18 |
tatcaaatcttctctcaaattatgttctttttcagattttgatggagatgaaattgaaatccaattggtaaagtgtttgacagaaaatggcacacagttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |||| |
|
|
| T |
54219170 |
tatcaaatcttctctcaaattatgttctttttcagattttgatggagatgaaattgaaatccaattgttaaagtgtttgacagaaaatgccaca--gttc |
54219073 |
T |
 |
| Q |
118 |
tagaggagatcaacatattttgttccggaggtttatcatcaaatttgaagaagctgactgatgtgaggaaccacgtgcaatctttaggcctgggaagttg |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54219072 |
tagaggcgatcaacatattttgttccggaggtttatcatcaaatttgaagaagctgactgatgtgaggaaccacgtgcaatctttaggcctgggaagttg |
54218973 |
T |
 |
| Q |
218 |
cgtcttcaaatttcactgaatttcctttttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54218972 |
cgtcttcaaatttcactgaatttcctttttt |
54218942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 217
Target Start/End: Complemental strand, 31217426 - 31217373
Alignment:
| Q |
164 |
gaagaagctgactgatgtgaggaaccacgtgcaatctttaggcctgggaagttg |
217 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| |||||||| |||||||||| |
|
|
| T |
31217426 |
gaagaagctggctgatgtgaggaaccaattgcaagctttaggcatgggaagttg |
31217373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University