View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3408_high_9 (Length: 224)
Name: NF3408_high_9
Description: NF3408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3408_high_9 |
 | |
|
| [»] scaffold0553 (1 HSPs) |
| | |
|
| [»] scaffold0086 (2 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 70 - 206
Target Start/End: Original strand, 15603052 - 15603188
Alignment:
| Q |
70 |
tcccattcccttgattaaacacgcctgattgaacattccctcaatataatgaatttttaaatgaatatttgcaaacactaagttatgttactacttcctt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15603052 |
tcccattcccttgattaaacacgcctgattgaacattccctcaatataatgaatttttaaatgaatatttgcaaacactaagttatgttactacttcctt |
15603151 |
T |
|
| Q |
170 |
ttcttattgattaaatttcttttgaaactaatctgtt |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
15603152 |
ttcttattgaataaatttcttttgaaactaagctgtt |
15603188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0553 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: scaffold0553
Description:
Target: scaffold0553; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 70 - 200
Target Start/End: Original strand, 7137 - 7267
Alignment:
| Q |
70 |
tcccattcccttgattaaacacgcctgattgaacattccctcaatataatgaatttttaaatgaatatttgcaaacactaagttatgttactacttcctt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7137 |
tcccattcccttgattaaacacgcctgattgaacattccttcaatataatgaatttttaaatgaatatttgcaaacactaagttatgttactacttcctt |
7236 |
T |
|
| Q |
170 |
ttcttattgattaaatttcttttgaaactaa |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
7237 |
ttcttattcattaaatttcttttgaaactaa |
7267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 73 - 200
Target Start/End: Complemental strand, 42152 - 42027
Alignment:
| Q |
73 |
cattcccttgattaaacacgcctgattgaacattccctcaatataatgaatttttaaatgaatatttgcaaacactaagttatgttactacttccttttc |
172 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42152 |
cattcccttgattaaacacgtctgattgaacattccctcaatataatga--ttttaaatgaatatttgcaaacactaagttatgttactacttccttttc |
42055 |
T |
|
| Q |
173 |
ttattgattaaatttcttttgaaactaa |
200 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
42054 |
ttatttattaaatttcttttgaaactaa |
42027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 124 - 206
Target Start/End: Complemental strand, 37394 - 37312
Alignment:
| Q |
124 |
ttttaaatgaatatttgcaaacactaagttatgttactacttccttttcttattgattaaatttcttttgaaactaatctgtt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |
|
|
| T |
37394 |
ttttaaatgaatatttgcaaacactaagttatgttactacttccttttcttattgagtaaatttcttttgaaactaagctgtt |
37312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 46
Target Start/End: Complemental strand, 20281418 - 20281384
Alignment:
| Q |
12 |
gagcagagaaaacgaactcaaaactcattgcactt |
46 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
20281418 |
gagcagagaaaacgaactcagaactcattgcactt |
20281384 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 45
Target Start/End: Complemental strand, 11893717 - 11893684
Alignment:
| Q |
12 |
gagcagagaaaacgaactcaaaactcattgcact |
45 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
11893717 |
gagcagagaaaacgaactcagaactcattgcact |
11893684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University