View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3408_low_4 (Length: 290)
Name: NF3408_low_4
Description: NF3408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3408_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 54 - 276
Target Start/End: Complemental strand, 30620812 - 30620590
Alignment:
| Q |
54 |
aaatttatctattgtcccacatcctatgcaatatgcacgaaagaggtgtgcaaggagtttctcacgcaccaaatgacaatcaatcttgttgtgtttggtg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620812 |
aaatttatctattgtcccacatcctatgcaatatgcacgaaagaggtgtgcaaggagtttctcacgcaccaaatgacaatcaatcttgttgtgtttggtg |
30620713 |
T |
 |
| Q |
154 |
cattcgtggaagctgaaatttgcagcaatcatgcatctgttattatgtacaatagtaacaactccaaggatgcttttctgttgattttctctaatcaagc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30620712 |
cattcgtggaagctgaaatttgcagcaatcatgcatctgttattatgtacaatagtaacaactccaaggatgctttcctgttgattttctctaatcaagc |
30620613 |
T |
 |
| Q |
254 |
ttctcttggttggtgtgtttgtt |
276 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
30620612 |
ttctcttggttggtgtgtttgtt |
30620590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 58
Target Start/End: Complemental strand, 30620863 - 30620824
Alignment:
| Q |
19 |
atacaacaactaattaacagaattatagagtaactaaatt |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30620863 |
atacaacaactaattaacagaattatagagtaactaaatt |
30620824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University