View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3408_low_6 (Length: 252)
Name: NF3408_low_6
Description: NF3408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3408_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 15565303 - 15565538
Alignment:
| Q |
7 |
ctcttctcatcctcaacacaatattgaaaaccattatttttcattttcaaacatgccagaattgtttttcaaacatgccagaactaaaaacacacccaaa |
106 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15565303 |
ctcttctcatcctctacacaatattgaaaaccattatttttcattttcaaacatgccagaattgtttttcaaacatgccagaactaaaaacacacccaaa |
15565402 |
T |
 |
| Q |
107 |
attcctaaaacacctcgtgttgaaccatcacaacaggaaatttatgagttgcaaaccatggcctcctatctcttgcaagcaaacgcatatttgcgtaaat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15565403 |
attcctaaaacacctcgtgttgaaccatcacaacaggaaatttatgagttgcaaaccatggcctcctatctcttgcaagcaaacgcatatttgcgtaaat |
15565502 |
T |
 |
| Q |
207 |
ggttggcagaagaggcgttacccaaaattccctatg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15565503 |
ggttggcagaagaggcgttacccaaaattccctatg |
15565538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University