View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3408_low_7 (Length: 243)
Name: NF3408_low_7
Description: NF3408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3408_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 15908486 - 15908263
Alignment:
| Q |
1 |
agaaattcataccatgatctgaaaatattatcttgcaagattttgttgctgcctttttgtatgcatagattcaagcca-atatagaaactgtactaacat |
99 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
15908486 |
agaaattcaaaccatgatctgaaaatattatcttgcaagattttgttgctgcctttttgtatgcatagattcaagccatatatagcaactgtactaacat |
15908387 |
T |
 |
| Q |
100 |
tttagccttttnnnnnnntaaaatagaaacagtactaatttcttgtttgagtaaatttgtcaaaacagaggaaactttactaaaccaaaaatagaagaag |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15908386 |
tttagccttttcaaaaaataaaatagaaacagtactagtttcttgtttgagtaaatttgtcaaaacagaggaaactttactaaaccaaaaatagaagaag |
15908287 |
T |
 |
| Q |
200 |
aagtagtcagagagaattttctta |
223 |
Q |
| |
|
|| ||||||||||||||||||||| |
|
|
| T |
15908286 |
aactagtcagagagaattttctta |
15908263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University