View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_high_17 (Length: 407)
Name: NF3410_high_17
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_high_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 291
Target Start/End: Complemental strand, 31697046 - 31696774
Alignment:
| Q |
19 |
gatgaaaatcatgagatttcgtctaaataatatccagaaccatccaaatttaactcaaatatgcttgatggcttaacaattcctttgaatgtggttgaca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31697046 |
gatgaaaatcatgagatttcgtctaaataatatccagaaccatccaaatttaagtcaaatatgcttgatggcttaacaattcctttgaatgtggttgaca |
31696947 |
T |
 |
| Q |
119 |
acctttttgatgtgcagtttgatgttgaagaatttcataacaaagtatccccatccttggctcttagcttctttgtttcctccttggctctcagcttctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31696946 |
acctttttgatgtgcagtttgatgttgaagaatttcataacaaagtatccccattcttggctcttagcttctttgtttcctccttggctctcagcttctt |
31696847 |
T |
 |
| Q |
219 |
gaattcgatcatgatttctaatcttgtcgaaaatagaactgcatttgggaaaaacgtcgtcttttgattaaaa |
291 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31696846 |
gaattcgatcgtgatttctaatcttgtcgaaaatagaactgcatttgggcaaaacgtcgtcttttgattaaaa |
31696774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University