View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_high_29 (Length: 309)
Name: NF3410_high_29
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_high_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 8e-24; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 93 - 170
Target Start/End: Complemental strand, 6934162 - 6934081
Alignment:
| Q |
93 |
taggtgtgaactgaaaacaaatggatccaggtgtgagt----atccagaagtttaacaataattctgctattcttttacaat |
170 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6934162 |
taggtgggaactgaaaacaaatggatccaggtgtgagtgagtatgcagaagtttaacaataattctgctattcttttacaat |
6934081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 248 - 291
Target Start/End: Complemental strand, 6933979 - 6933936
Alignment:
| Q |
248 |
tcaaaatgatcactttgtaatttggtcaataatagtccctactt |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6933979 |
tcaaaatgatcactttgtaatttggtcaataatagtccctactt |
6933936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University