View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_high_62 (Length: 227)
Name: NF3410_high_62
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_high_62 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 71 - 227
Target Start/End: Original strand, 14544337 - 14544493
Alignment:
| Q |
71 |
gtgaaattatcaataaaagcaggaagacttcattcataatattagtcgtcttgaggtaagtaataatataaaataaagatacggaattgttgattactta |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14544337 |
gtgaaattatcaataaaagcaggaagacttcattcataatattagtcgtcttgaggtaagtaataatataaaataaagatacggaattgttgattactta |
14544436 |
T |
 |
| Q |
171 |
actatactatatactactagtagtatttgtattgtgtgagaactttatctttttctt |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14544437 |
actatactatatactactagtagtatttgtattgtgtgagaactttatctttttctt |
14544493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University