View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_high_64 (Length: 207)
Name: NF3410_high_64
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_high_64 |
 |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 14 - 189
Target Start/End: Complemental strand, 13716035 - 13715860
Alignment:
| Q |
14 |
catagggaatgtggagaatgttctcttttggaaggacatgtggcccggtgagccattggtgcagtctctaagcattcctactcatttgcatgcttagctg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13716035 |
catagggaatgtggagaatgttctcttttggaagcacatgtggcccggtgagccattggtgaagtctctaagcattcctactcatttgcatgcttagctg |
13715936 |
T |
 |
| Q |
114 |
aacatgaaggtgtcatattacattgtgcaccaacaatggcagattccctcatacattagccgtaaatatcctactt |
189 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13715935 |
aacatgaaggtgtcatattacatcgtgcaccaacaatggcagattccctcatacattagccctaaatatcctactt |
13715860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 36299 - 36130
Alignment:
| Q |
18 |
gggaatgtggagaatgttctcttttggaaggacatgtggcccggtgagccattggtgcagtctctaagcattcctactcatttgcatgcttagctgaaca |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |||| |||||||| |||||||||||||| ||||||||| | ||||| |||||| ||||| ||| |
|
|
| T |
36299 |
gggaatggggagaatgttctcttttggaaggacaggtggttgggtgagccgttggtgcagtctctcagcattccttcacattttcatgctcagctggaca |
36200 |
T |
 |
| Q |
118 |
tgaaggtgtcatattacattgtgcaccaacaatggcagattccctcatacattagccgtaaatatcctac |
187 |
Q |
| |
|
||||||||||| |||||||| ||||||| ||||||| ||||||| | |||||||| |||||||||||| |
|
|
| T |
36199 |
tgaaggtgtcagattacattctgcaccatcaatggcggattcccacctacattagttctaaatatcctac |
36130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University