View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_low_34 (Length: 284)
Name: NF3410_low_34
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 271
Target Start/End: Complemental strand, 14544781 - 14544517
Alignment:
| Q |
7 |
attagatgccacgtcatcttgaattccggcggaagaaggttccgccgccgtgaagatatcgtcggatccgaacataggaattcggttggttgatgaagtg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14544781 |
attagatgccacgtcatcttgaattccggcggaagaaggttccgccgccgtgaagatatcgtcggatccgaacataggaattcggttggttgatgaagtg |
14544682 |
T |
 |
| Q |
107 |
gtggacatgaggaaactgttgtagtctgccgggaagattagattctccggtgtcatcagggatttgtcgccgtattccaccgttgttggtactccgtaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14544681 |
gtggacatgaggaaactgttgtagtctgccgggaagattagattctccggtgtcatcagggatttgtcgccgtattccaccgttgttggtactccgtaca |
14544582 |
T |
 |
| Q |
207 |
tttcttccatcaccgtgatgatgctaaaactcacttttggattggaacttcttcttcttcttgtt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14544581 |
tttcttccatcaccgtgatgatgctaaaactcacttttggattggaacttcttcttcttcttgtt |
14544517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University