View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_low_44 (Length: 245)
Name: NF3410_low_44
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_low_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 15 - 230
Target Start/End: Original strand, 12015115 - 12015330
Alignment:
| Q |
15 |
tatatttgaaaaagataaagatgaaagagagtgaatgtgatggattcacaatgttctgggaagagagatatagagaaaatgaattgttgaatggatgtag |
114 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12015115 |
tatatttgaaagagataaagatgaaagagagtgaatgtgatagattcacaatatgctgggaagagagatatagagaaaatgaattgttgaaaggatgtag |
12015214 |
T |
|
| Q |
115 |
aaaaattgggtgtgtctagataccattattgnnnnnnntaaaatatgttatttgaacaatcnnnnnnnagaaaacttatgaaacaatcaaatatatacaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||||||||||| |||| | |||||||||||||||||||||||||||||| |
|
|
| T |
12015215 |
aaaaattgggtgtgtctagataccattattaaaaaaaaatatatatgttatttgaataatcttttttcaaaaaacttatgaaacaatcaaatatatacaa |
12015314 |
T |
|
| Q |
215 |
acaaacgtagatattg |
230 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
12015315 |
acaaacgtagatattg |
12015330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 36 - 127
Target Start/End: Original strand, 12045546 - 12045637
Alignment:
| Q |
36 |
tgaaagagagtgaatgtgatggattcacaatgttctgggaagagagatatagagaaaatgaattgttgaatggatgtagaaaaattgggtgt |
127 |
Q |
| |
|
||||||||| ||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
12045546 |
tgaaagagaatgaatgtgaatctttcacaatgtgataggaagagagatatagagaaaatgaattgttgaatggatgtaggaaaattaggtgt |
12045637 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University