View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_low_46 (Length: 240)
Name: NF3410_low_46
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 813313 - 813234
Alignment:
| Q |
10 |
aagaagattgcataagattttactatttcttccgtgaaatttggagtttgaaatatgtatgtatgtgtcaattactagga |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
813313 |
aagaagattgcataagattttactatttcttccatgaaatttggagtttgaaatatgtatgtatgtgtcaattactagga |
813234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 191 - 225
Target Start/End: Complemental strand, 813182 - 813148
Alignment:
| Q |
191 |
atttcgattaccttcttcattttgtaacatgatga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
813182 |
atttcgattaccttcttcattttgtaacatgatga |
813148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University