View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3410_low_46 (Length: 240)

Name: NF3410_low_46
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3410_low_46
NF3410_low_46
[»] chr1 (2 HSPs)
chr1 (10-89)||(813234-813313)
chr1 (191-225)||(813148-813182)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 813313 - 813234
Alignment:
10 aagaagattgcataagattttactatttcttccgtgaaatttggagtttgaaatatgtatgtatgtgtcaattactagga 89  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
813313 aagaagattgcataagattttactatttcttccatgaaatttggagtttgaaatatgtatgtatgtgtcaattactagga 813234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 191 - 225
Target Start/End: Complemental strand, 813182 - 813148
Alignment:
191 atttcgattaccttcttcattttgtaacatgatga 225  Q
    |||||||||||||||||||||||||||||||||||    
813182 atttcgattaccttcttcattttgtaacatgatga 813148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University