View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3410_low_56 (Length: 236)
Name: NF3410_low_56
Description: NF3410
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3410_low_56 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 27685849 - 27685623
Alignment:
| Q |
1 |
tttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttataacagctttttatgtaagattaagatatgatcatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685849 |
tttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttataacagctttttatgtaagattaagatatgatcatgatt |
27685750 |
T |
|
| Q |
101 |
nnnnnnn-tgaagttgattaatggaaggttaaacattttttaaaaaatttgagtgtgtgataaattttactaatgagttgattaattgcagctttctaac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685749 |
aaaaaaaatgaagttgattaatggaaggttaaacatttttaaaaaaatttgagtgtg--ataaattttactaatgagttgattaattgcagctttctaac |
27685652 |
T |
|
| Q |
200 |
aatgaagcacatccaggatttcatgatga |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27685651 |
aatgaagcacatccaggatttcatgatga |
27685623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 41268734 - 41268815
Alignment:
| Q |
1 |
tttcgatcgggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttataacagctttttatgtaagat |
82 |
Q |
| |
|
|||||||| || |||||||| ||||| ||||||||||| ||||| || |||||||||||||||||| |||| |||||||||| |
|
|
| T |
41268734 |
tttcgatctggctactttggtgcttccattaagcttcaacctggttatactgcaggagttataacatctttctatgtaagat |
41268815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 21085459 - 21085407
Alignment:
| Q |
10 |
ggatactttggcgcttcgattaagcttcatcctggctacactgcaggagttat |
62 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||| ||||| |||||||| |
|
|
| T |
21085459 |
ggatactttggtgctgcaattaagcttcatcctggctatactgctggagttat |
21085407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University