View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3411_low_5 (Length: 256)
Name: NF3411_low_5
Description: NF3411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3411_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 54543650 - 54543873
Alignment:
| Q |
16 |
atacgcggtagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgctaagttgaagaaataaaagaacacaaac |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54543650 |
atacgcgggagatacacaccagtcagggagtggtaggccagcaaggtttgaatgttgcatccagacatttgc-aagttgaagaaataaaagaacacaaac |
54543748 |
T |
 |
| Q |
116 |
tgataagacgagaaatggaagagtacagtttcagannnnnnnggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacagctg |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54543749 |
tgataagaagagaaatggaagagtacagtttcagatttttttggaacgtggttatataattaagtaaggtatgctgatagttttgcattggaaacagctg |
54543848 |
T |
 |
| Q |
216 |
ataattattaagtagaggagaggac |
240 |
Q |
| |
|
||||||||||||||| ||||||||| |
|
|
| T |
54543849 |
ataattattaagtagtggagaggac |
54543873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University