View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3411_low_7 (Length: 237)
Name: NF3411_low_7
Description: NF3411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3411_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 29091567 - 29091787
Alignment:
| Q |
1 |
gctgcaaaactaacaagtgttccagggtggtcgggtcggatatgggcgaggactggttgcacatttgatgcatccggaattggcaaatgccaaacaggtg |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29091567 |
gctgcgaaactaacaagtgttccagggtggtcgggtcggatatgggcgaggactggttgcacatttgatgcatccggaattggcaaatgccaaacgggtg |
29091666 |
T |
|
| Q |
101 |
attgtggtggaagacttgaatgtgatgggaatggtgcagctccacctacttcacttttcgagattacaattggacaaggcgatcaacaagattactatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
29091667 |
attgtggtggaagacttgaatgtgatgggaatggtgcagctccacctacttcacttttcgagattacaattggacaaggtgatcaacaagattactatga |
29091766 |
T |
|
| Q |
201 |
tgttagtatggttgatggata |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29091767 |
tgttagtatggttgatggata |
29091787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 58 - 220
Target Start/End: Original strand, 29084285 - 29084447
Alignment:
| Q |
58 |
tgcacatttgatgcatccggaattggcaaatgccaaacaggtgattgtggtggaagacttgaatgtgatgggaatggtgcagctccacctacttcacttt |
157 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||| |
|
|
| T |
29084285 |
tgcacatttgatgcattaggaattgacaagtgccaaacaggtgattgtggtggaagacttgaatgtgatgggaatggtgcagctccacgtgatggacttt |
29084384 |
T |
|
| Q |
158 |
tcgagattacaattggacaaggcgatcaacaagattactatgatgttagtatggttgatggat |
220 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
29084385 |
tcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatggat |
29084447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University