View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3414_high_21 (Length: 212)
Name: NF3414_high_21
Description: NF3414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3414_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 192
Target Start/End: Complemental strand, 29620416 - 29620243
Alignment:
| Q |
19 |
caaaggcagatgaacaaattagacgaaccttgggttcaggacatgccgaatgtcatctaacgaaggatcattaacttcataaccatcgggaagacagtag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29620416 |
caaaggcagatgaacaaattagacgaaccttgggttcaggacatgccaaatgtcatctaacgaaggatcattaacttcataaccatcgggaagacagtag |
29620317 |
T |
 |
| Q |
119 |
actttttcagttaggagattgatataaacatggtgtccagcttccaagctatgcgtataggcatgagacctttt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29620316 |
actttttcagttaggagattgatataaacatggtgtccagcttccaagctatgcgtataggcatgagacctttt |
29620243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 23 - 192
Target Start/End: Complemental strand, 29659403 - 29659234
Alignment:
| Q |
23 |
ggcagatgaacaaattagacgaaccttgggttcaggacatgccgaatgtcatctaacgaaggatcattaacttcataaccatcgggaagacagtagactt |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||| ||||||||||||||| |||| | |
|
|
| T |
29659403 |
ggcaaatgaacaaattagacgaaccttgggttcaggacatgccgaatgtcatctaatgaaggatcatcaatttcatagccatcgggaagacagaagacct |
29659304 |
T |
 |
| Q |
123 |
tttcagttaggagattgatataaacatggtgtccagcttccaagctatgcgtataggcatgagacctttt |
192 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
29659303 |
tttcagtcaggagattgatataaacatggtgtccagcttccagactatgcgtataggcatgagacttttt |
29659234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University