View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3414_high_8 (Length: 317)
Name: NF3414_high_8
Description: NF3414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3414_high_8 |
 |  |
|
| [»] scaffold0072 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0072 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 289
Target Start/End: Complemental strand, 44489 - 44201
Alignment:
| Q |
1 |
gcttctgtttgtccgtcggattgggggtgatacgctgagctcatagataaagtggtgccacttagcttaaacaaatttttccagaaagagctggtgaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44489 |
gcttctgtttgtccgtcggattgggggtgatacgctgagctcatagataaagtggtgccacttagcttaaacaaattttgccagaaagagctggtgaaca |
44390 |
T |
 |
| Q |
101 |
ccttatcacgatccgacacaatactcttgggaaatccatgtaacttaactacagtatgtagaaaagcttctgcaactttcaagctagtaaaatcagattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44389 |
ccttatcacgatccgacacaatactcttgggaaatccatgtaacttaactacaatatgtagaaaagcttctgcaactttcaagctagtaaaatcagattt |
44290 |
T |
 |
| Q |
201 |
caagggtacaaaatggccatatttggagagcctatcaaccactaccattatcacagtgaagccatgtgaaggtggaagacccgtgatga |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44289 |
caagggtacaaaatggccatatttggagagcctatcaaccactaccattatcacagtgaagccatgtgaaggtggaagacccgtgatga |
44201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University