View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3414_low_21 (Length: 237)
Name: NF3414_low_21
Description: NF3414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3414_low_21 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 5562682 - 5562902
Alignment:
| Q |
18 |
ccaatgtcacctctatctacccc-ctcacgttcagcatgaaaacccgcgaaactgagaacaaaacgctaccgttttattttatctagttttattttccat |
116 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5562682 |
ccaatgtcacctctatctacccccctcacgttcagcatgaaaacccgcgaaactgagaacaaaacgctaccgttttattttatctagttttattttccat |
5562781 |
T |
|
| Q |
117 |
aaagctttggttaatttttagggttcattcatcacattgaaacggcgcagcagcattgtgaaaactccatggacgacgtaagagcaacctctgcttgggt |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
5562782 |
aaagcttcggttaatttttagggttcattcatcacattgaaacggcgcagcagcattgtgaaaactccatggacgacgtaagatcaacctctgcttgggt |
5562881 |
T |
|
| Q |
217 |
cgctagtcactcctctcatgt |
237 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
5562882 |
cgctagccactcctctcatgt |
5562902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University