View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3414_low_9 (Length: 344)
Name: NF3414_low_9
Description: NF3414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3414_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 262
Target Start/End: Complemental strand, 28997711 - 28997468
Alignment:
| Q |
19 |
ttagttttttcagaaaaagaaaatttatagagatgatgggtcattgtcttcatgagagtcacacacataggaaagtgtgaatccaatatgtaaagatcga |
118 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28997711 |
ttagttttttcagaaaaagaaaaattatagagatgatgggtcattgtcttcatgagagtcacacacataggaaagtgtgaatccaatatgtaaagatcga |
28997612 |
T |
 |
| Q |
119 |
tatattcttgtggaagatacaaatgaaaatgggatagtgacatgtgaaggtaactaaatttcatttggtgttattcgggttggtggtgaatttcacataa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28997611 |
tatattcttgtggaagatacaaatgaaaatgggagagtgacatgtgaaggtaactaaatttcacttggtgttattcgggttggtggtgaatttcacataa |
28997512 |
T |
 |
| Q |
219 |
tcactatttcacaccgtaattttggaaactaattatattataga |
262 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
28997511 |
tcactatttcacaccgtaattttggaaaataattatattataga |
28997468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University