View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_high_21 (Length: 322)
Name: NF3415_high_21
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_high_21 |
 |  |
|
| [»] scaffold0257 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0257 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: scaffold0257
Description:
Target: scaffold0257; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 13 - 304
Target Start/End: Complemental strand, 20325 - 20033
Alignment:
| Q |
13 |
aatatttactgtttttcaattttaccttgtgaactcattagtttcctctgttcgtttgagaaaaatccaaactggatagtgacaataacggtgtttctaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20325 |
aatatttactgtttttcaattttaccttgtgaactcattagtttcctctgttcgtttgagaaaaatccaaactggatagtgacaataacggtgtttctaa |
20226 |
T |
 |
| Q |
113 |
atagtatctgatcgaatcgaagcattctgacccaactttttt-gctaagagattactacaattaaatgcaaacaaaatgaaggcattgctttgctagact |
211 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20225 |
atagtatctgatcgaatcaaagcattctgacccaactttttttgctaagagattactacaattaaatgcaaacaaaatgaaggcattgctttgctagact |
20126 |
T |
 |
| Q |
212 |
gcaattgtaaggttctggttgatatataaatgtatgttcgagcaataaataaaatattcaaggataaagaaaatcagggaacttctagaatgc |
304 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
20125 |
gcaattgtaaggttttggttgatatataaatgtatgttcgagcaataaataaaatattcaaggataaagaaaatcagggaactgctagaatgc |
20033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 243 - 293
Target Start/End: Complemental strand, 8021830 - 8021780
Alignment:
| Q |
243 |
gtatgttcgagcaataaataaaatattcaaggataaagaaaatcagggaac |
293 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
8021830 |
gtatgtccgagcaataaataaaatattgaaggataaagaaaagcagggaac |
8021780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 149 - 206
Target Start/End: Original strand, 49357 - 49414
Alignment:
| Q |
149 |
ttttttgctaagagattactacaattaaatgcaaacaaaatgaaggcattgctttgct |
206 |
Q |
| |
|
|||||||| |||| |||| ||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
49357 |
ttttttgccaagatattagtacaattcaatgcatacaaaatgaaggccttgctttgct |
49414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 244
Target Start/End: Original strand, 21462478 - 21462574
Alignment:
| Q |
149 |
ttttttgctaagagattactacaattaaatgcaaacaaaatgaaggcattgcttt-gctagactgcaattgtaaggttctggttgatatataaatgt |
244 |
Q |
| |
|
|||||||| |||| |||| ||||||| ||||||| ||||||||||| ||||||| ||| || ||||||| | | ||||| |||||||||||||| |
|
|
| T |
21462478 |
ttttttgccaagatattagtacaattcaatgcaatcaaaatgaaggtcttgctttggcttgattgcaattacatgagtctggatgatatataaatgt |
21462574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University