View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_high_26 (Length: 301)
Name: NF3415_high_26
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 138 - 293
Target Start/End: Original strand, 42021888 - 42022041
Alignment:
| Q |
138 |
tttcacggggtaaatagcagtactactatcatgcttttaatatggaggtggtatacgaacatttgccacatttttgtgtacattgtgggattataggcca |
237 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021888 |
tttcacggggtaaatagcagtactact--catgcttttaatatggaggtggtatacgaacatttgccacatttttgtgtacattgtgggattataggcca |
42021985 |
T |
|
| Q |
238 |
taatgtcactaagaaagatgtcacgacgacatccaagaactaaataacaattattt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021986 |
taatgtcactaagaaagatgtcacgacgacatccaagaactaaataacaattattt |
42022041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 7 - 139
Target Start/End: Original strand, 42021720 - 42021852
Alignment:
| Q |
7 |
gtgcatacacgctaccagcatgttcgtgggccgtggcaaacagtttcattagtactactgacttttgacggttttcctaagaaacaataacataaacagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42021720 |
gtgcatacacgctaccagcatgttcgtgggccgtggtaaacagtttcattagtactactgacttttgacggttttcctaagaaacaataacataaacagt |
42021819 |
T |
|
| Q |
107 |
tctacatgcatatctagcacaactccttgagtt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42021820 |
tctacatgcatatctagcacaactccttgagtt |
42021852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University