View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_high_32 (Length: 264)
Name: NF3415_high_32
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 247
Target Start/End: Original strand, 45867954 - 45868193
Alignment:
| Q |
8 |
gagcagagagagcgatgtgattttcgaatcggtgatgaatctgaatccacaactcttcttcaacgaagttctcaacactgttgatgatttcgtcctcgat |
107 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45867954 |
gagcagcgagagcgatgcgattttcgaatcggtgatgaatttgaatccacaactcttcttcaacgaagttctcaacactgttgatgatttcgtcctcgat |
45868053 |
T |
|
| Q |
108 |
actttcgatttctacttccagtaacccctttcgcttcttcttcttctttcaaattttaattgctgttataccaaattgattaaatttaaattaaatctcg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868054 |
actttcgatttctacttccagtaacccctttcgcttcttcttcttctttcaaattttaattgttgttataccaaattgattaaatttaaattaaatctcg |
45868153 |
T |
|
| Q |
208 |
ttgtttcagggaagcatccaccaagctcaatgccgaagct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45868154 |
ttgtttcagggaagcatccaccaagctcaatgctgaagct |
45868193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 28 - 132
Target Start/End: Complemental strand, 45983033 - 45982929
Alignment:
| Q |
28 |
ttttcgaatcggtgatgaatctgaatccacaactcttcttcaacgaagttctcaacactgttgatgatttcgtcctcgatactttcgatttctacttcca |
127 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| || ||||||||||||||||||||||||| |
|
|
| T |
45983033 |
tttttgaatcggtgatgaatctgaatccacaactcttcttcaacgaagttctcaacaccgttgacgatttcttcatcgatactttcgatttctacttcca |
45982934 |
T |
|
| Q |
128 |
gtaac |
132 |
Q |
| |
|
||||| |
|
|
| T |
45982933 |
gtaac |
45982929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 247
Target Start/End: Complemental strand, 45982850 - 45982812
Alignment:
| Q |
209 |
tgtttcagggaagcatccaccaagctcaatgccgaagct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45982850 |
tgtttcagggaagcatccaccaagctcaatgctgaagct |
45982812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University