View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_high_41 (Length: 240)
Name: NF3415_high_41
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_high_41 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 104 - 226
Target Start/End: Complemental strand, 52579870 - 52579748
Alignment:
| Q |
104 |
aagtcaagattatttctctcacaattgcaaaaactaattctttaagatagttgaattcggttagaggaattgacctctttaaacatatatttttcttatg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579870 |
aagtcaagattatttctctcacaattgcaaaaactaattctttaagatagttgaattcggttagaggaattgacctctttaaacatatatttttcttatg |
52579771 |
T |
|
| Q |
204 |
atttattttcaccggttagaaat |
226 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
52579770 |
atttattttcaccagttagaaat |
52579748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 52579910 - 52579871
Alignment:
| Q |
1 |
atctttcaatgctaacggtgcaagtggcaaggtttttttt |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52579910 |
atctttcaatgctaacggtgcaagtggcaaggtttttttt |
52579871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University