View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_high_50 (Length: 219)
Name: NF3415_high_50
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_high_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 4 - 205
Target Start/End: Original strand, 9630667 - 9630868
Alignment:
| Q |
4 |
gtgtttgtatccgtgcttcatagattttaaaagaagaaaacataattgcttctatagcactctaatatagaagaccaatcaaaaattaaaatttttgatt |
103 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630667 |
gtgtctgtatccgtgcttcatagattttaaaagaagaaaacataaatgcttctatagcactctaatatagaagaccaatcaaaaattaaaatttttgatt |
9630766 |
T |
|
| Q |
104 |
aaattgcaccaaaccaaattgcaccaaaacaactgaactaaaccataaacttggtttggtttatgaatcatgcaaacccctaactaattgaatttaaaac |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9630767 |
aaattgcaccaaaccaaattgcaccaaaacaactgaactaaaccataaatttggtttggtttatgaatcatgcaaacccctaactaattgaatttaaaac |
9630866 |
T |
|
| Q |
204 |
tt |
205 |
Q |
| |
|
|| |
|
|
| T |
9630867 |
tt |
9630868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 134 - 185
Target Start/End: Complemental strand, 7528181 - 7528130
Alignment:
| Q |
134 |
aactgaactaaaccataaacttggtttggtttatgaatcatgcaaaccccta |
185 |
Q |
| |
|
|||||||||||||||| | ||||||||||| |||||||||||| ||||||| |
|
|
| T |
7528181 |
aactgaactaaaccatcagtttggtttggttcatgaatcatgcacaccccta |
7528130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University