View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_low_24 (Length: 319)
Name: NF3415_low_24
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 21 - 296
Target Start/End: Complemental strand, 24677548 - 24677273
Alignment:
| Q |
21 |
gcccaccaatcaacggcaaactcgtgtccgtcaccgcgaacaacctccggtgaaacatattcctccgttccgacgaatgagttagaccgttcgccatttg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677548 |
gcccaccaatcaacggcaaactcgtgtccgtcaccgcgaacaacctccggtgaaacatattcctccgttccgacgaatgagttagaccgttcgccatttg |
24677449 |
T |
|
| Q |
121 |
aaaaactcaatttacgtcggctcaccggactaacccgtgatgacttagccttcttcaaattcaaagcatgcagccgattatgattatgagaagattcagt |
220 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677448 |
agaaactcaatttacgtcggctcaccggactaacccgtgctgacttagccttcttcaaattcaaagcatgcagccgattatgattatgagaagattcagt |
24677349 |
T |
|
| Q |
221 |
tggaagaagaggtatccaacgagagaaatttcgacgatgttttcgcgaagattctggaaactttgaatctggtaaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24677348 |
tggaagaagaggtatccaacgagagaaatttcgacgatgttttcgcgaagattctggaaactttgaatctggtaaa |
24677273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University