View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_low_27 (Length: 302)
Name: NF3415_low_27
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_low_27 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 21 - 297
Target Start/End: Complemental strand, 32506359 - 32506081
Alignment:
| Q |
21 |
aaggcatagttgtgaatcaagaaagtggggactatgttcaattttataaatgggtgtatttttcttttggaacgggaccaatttaaatcttatgaattta |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32506359 |
aaggcatagttgtgaatcaagaaagtggggactatgttcaattttataaatgggtgtatttttcttttggaacgggaccaatttaattcttatgaattta |
32506260 |
T |
 |
| Q |
121 |
atgtctgaaattacttcttgcccacttaattgattgggtagctggaccannnnnnnnnnnnnggaagattatgagccattgatttggagattgatgcgta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32506259 |
atgtctgaaattacttcttgcccacttaattgattgggtagctggacca-ttttttttttttggaagattatgagccattgatttggagattgatgcata |
32506161 |
T |
 |
| Q |
221 |
cttgtggtggagcatggaacacttatattattattaatcagtaaagtctaata---catcatatctacggttaataatca |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||| |
|
|
| T |
32506160 |
cttgtggtggagcatggaacacttatattattattaatcagtaaagtctactacatcatcatatctacggttaatcatca |
32506081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University