View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_low_38 (Length: 253)
Name: NF3415_low_38
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_low_38 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 48 - 253
Target Start/End: Complemental strand, 35833118 - 35832913
Alignment:
| Q |
48 |
atactgttgatcatcccagttcagtattcaaataatcattatgatatatgtaaaaattatttaactatgtttaatgtcttgaaaatctttttccaagtta |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35833118 |
atactgttgatcatcccagttcagtattcaaataatcattatgatatatgtaaaaattatttaactatgtttaatgtcttgaaaatctttttccaagtta |
35833019 |
T |
|
| Q |
148 |
tgggagtcgagaacaagttagccactctatctgtgtctactgtattcctgctttttctttagtaactgaactatacagtaggaaaatataattatttctc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35833018 |
tgggagtcgagaacaagttagccactctatctgtgtctactgtattcctgctttttctttagtaactgaactctacagtaggaaaatataattatttctc |
35832919 |
T |
|
| Q |
248 |
tacctc |
253 |
Q |
| |
|
|||||| |
|
|
| T |
35832918 |
tacctc |
35832913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University