View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3415_low_56 (Length: 208)
Name: NF3415_low_56
Description: NF3415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3415_low_56 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 37879560 - 37879744
Alignment:
| Q |
1 |
atattgattatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcagaaaaaccttca |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879560 |
atattgatgatgagggtaaggaacagcaccagctttcaccaagaaatcttcaagagtaacttcatcaccaccaccggcaccgcaagcagaaaaaccttca |
37879659 |
T |
|
| Q |
101 |
tcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37879660 |
tcagaagaaggatgatgataatgttgttgatgatgaagatggtttgcaccaccatcagcgacgatgtccgtccaaacatcgtcaa |
37879744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University