View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3417_high_14 (Length: 236)
Name: NF3417_high_14
Description: NF3417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3417_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 127
Target Start/End: Original strand, 26645406 - 26645536
Alignment:
| Q |
1 |
aagacatggaaatgtgtttccatgacaggttatattggccttagcctaaggttaaggtaactgatttgatgaatctgaagca----ataactagatgaat |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
26645406 |
aagacatggaaatgtgtttccatgacaggttatattggccttagcctaaggttaaggtaactgatttgatgaatctaaagcaatatataattagatgaat |
26645505 |
T |
 |
| Q |
97 |
cacttgatgacttcattggaaaacagatggg |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26645506 |
cacttgatgacttcattggaaaacagatggg |
26645536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 221
Target Start/End: Original strand, 26645552 - 26645598
Alignment:
| Q |
171 |
ccatcaatgacatgcacccatagctaatagagaaattggttgggtaggttt |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26645552 |
ccatcaatgacatgcacccata----atagagaaattggttgggtaggttt |
26645598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 213
Target Start/End: Original strand, 5983442 - 5983499
Alignment:
| Q |
156 |
aatatgcatcaatgaccatcaatgacatgcacccatagctaatagagaaattggttgg |
213 |
Q |
| |
|
|||||||||||||| |||||||| | ||||| ||||| |||| |||||||||| |||| |
|
|
| T |
5983442 |
aatatgcatcaatggccatcaattatatgcatccataactaaaagagaaattgattgg |
5983499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University