View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3417_low_11 (Length: 250)
Name: NF3417_low_11
Description: NF3417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3417_low_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 8 - 250
Target Start/End: Original strand, 21312074 - 21312315
Alignment:
| Q |
8 |
cgaagaaaatcacaaaccgagcttcccacaatctcccacgatttttgatagaagccagcagaaaaaccatccggtccaggtgccttccacggattcatat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21312074 |
cgaacaaaatcacaaaccgagcttcccacaatctcc-acgatttttgatagaagccagcaggaaaaccatccggtccaggtgccttccacggattcatat |
21312172 |
T |
|
| Q |
108 |
taaacaaagcacttctgacttcgttatcttctattggcgcactcaaacacactaacacatcctcctccaacgtaggataagtgacatttgtttgaagcca |
207 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21312173 |
taaacaacgcacttctgacttcgttatcttctattggcgcactcaaacacactaacacatcctcctccaacgtaggataagtgacatttgtttgaagcca |
21312272 |
T |
|
| Q |
208 |
ctccattctacaatgattattggaaaataacttcttataaaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21312273 |
ctccattctacaatgattattggaaaataacttcttataaaac |
21312315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University