View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3417_low_13 (Length: 249)
Name: NF3417_low_13
Description: NF3417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3417_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 23 - 244
Target Start/End: Original strand, 480908 - 481127
Alignment:
| Q |
23 |
ttggtattggtatgtatattcaaaggttgtttgatattgtcttaaaccaaaaaagttatttggttttggctcgaacaatttagttttctcccatatattt |
122 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
480908 |
ttggtattggtatgtatattcgaaggttgtttgatgttgccttaaaccaaaaaagttatttggtgttggctcgaacaatttagttttctcccatatattt |
481007 |
T |
 |
| Q |
123 |
tatggatgagagggaaaagcgtatgattttttgggtcctttgaatttaatttgttgtcttcagctgaacaatgttgattttgaactttattttaagtgga |
222 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
481008 |
tatggatgagaggg--aagcgtatgatttgttgggtcctttgaatttaatttgttgtcttcagctgaacaatgttgattttgaactttattttaagtgga |
481105 |
T |
 |
| Q |
223 |
ttctttatagttttcttctctc |
244 |
Q |
| |
|
||||| ||| |||||||||||| |
|
|
| T |
481106 |
ttcttgataattttcttctctc |
481127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University