View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3417_low_14 (Length: 245)
Name: NF3417_low_14
Description: NF3417
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3417_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 21312336 - 21312462
Alignment:
| Q |
1 |
ttgctcaacatcttctatccactgcccttgatcatctcttagcatgagaatatcattttttctcctt------ctagtaacagttttcaaatggtaatat |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21312336 |
ttgctcaacatcttctatccactgcccttgatcatctcttagcatgagaatatcattctttctccttctagacctagtaacagttttcaaatggtaatat |
21312435 |
T |
 |
| Q |
95 |
tgcgtattacgatcaccatcagctaac |
121 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
21312436 |
cgcgtattacgatcaccatcagctaac |
21312462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 129 - 232
Target Start/End: Original strand, 21312630 - 21312733
Alignment:
| Q |
129 |
cgtaaattttgaacctatagcaccgaggtccatcaaatggaacatatccattcgctccttgaatttattgcacttcctaatagagattggagcccatcct |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21312630 |
cgtaaattttgaacctatagcaccgaggtccatcaaatggcacatatccattcgctccttgaatttattgtacttcctaatagagattggagcccatcct |
21312729 |
T |
 |
| Q |
229 |
ttct |
232 |
Q |
| |
|
|||| |
|
|
| T |
21312730 |
ttct |
21312733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University