View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3419_high_5 (Length: 252)
Name: NF3419_high_5
Description: NF3419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3419_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 11404163 - 11403945
Alignment:
| Q |
13 |
aatatgttgtggaattatactgtcaagttttgcagctattttcataaactttggtcttagccagaaaactcggccggtatttctctcttcctttttacaa |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11404163 |
aataggttgtggaattatactgtcaagttttgcagctattttcataaactttggtcttagccagaaaactcgcccggtatttctctcttcctttttacaa |
11404064 |
T |
 |
| Q |
113 |
atatacaacacatggttgataaataaatagtccgaacttgtttatatccatatgttttgggattttatttcatgctaatgcatttatgttaggtgaaata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11404063 |
atatacaacacatggttgataaataaatagtccgaacttgtttatatccatatgttttgggattttatttcatgctaatgcatttatgttaggagaaata |
11403964 |
T |
 |
| Q |
213 |
aactcttaggccttaagat |
231 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
11403963 |
aactcttaggccttaagat |
11403945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University