View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3422_high_7 (Length: 252)
Name: NF3422_high_7
Description: NF3422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3422_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 51670822 - 51671046
Alignment:
| Q |
11 |
cacagaggatgcttttatgctacctattctacacggctgcataattgagtttttgaattagctcttgttctttctcatttttctgaaataaatgagaaga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670822 |
cacagaggatgcttttatgctacctattctacacggctgcataattgagtttttgaattagctcttgttctttctcatttttctgaaataaatgagaaga |
51670921 |
T |
 |
| Q |
111 |
atggtgattgtttttatttaaaattaacaaacatgcatgagatttgacatgtttccaagtttgcttcaaatggtggaattgctactgtgatcaatgtaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51670922 |
atggtgattgtttttatttaaaattaacaaacatgcatgagatttaacatgtttccaagtttgcttcaaatggtggaattgctactgtgatcaatgtaga |
51671021 |
T |
 |
| Q |
211 |
gataaaagggaaatgaatgctctcc |
235 |
Q |
| |
|
|||||||| |||||||||||||||| |
|
|
| T |
51671022 |
gataaaagtgaaatgaatgctctcc |
51671046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University