View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3422_low_12 (Length: 229)
Name: NF3422_low_12
Description: NF3422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3422_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 48100267 - 48100067
Alignment:
| Q |
14 |
caaaggaacaaaagatgaaggaattgccatttgccttgagttagttgaaaagaattaacctttttcaatatgtgtattggatacatcaa-ttcatgcctt |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
48100267 |
caaaggaacaaaagatgaaggatttgccatttgccttgagttagttgaaaagaattaacctttttcaatatgtgtattggatacatcaatttgatgcctt |
48100168 |
T |
|
| Q |
113 |
tttatagccacnnnnnnnnaaacaataaaagagtgaattttaggtagaatgaactttttggtggtatttaattgaaatgaattgtttcaagttgcatgtt |
212 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48100167 |
tttatagccac-tttttttaaacaataaaagagtgaattttaggtagaatgaactttttggtggtatttaattgaaatgaattgtttcaagttgcatgtt |
48100069 |
T |
|
| Q |
213 |
tt |
214 |
Q |
| |
|
|| |
|
|
| T |
48100068 |
tt |
48100067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University