View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_high_10 (Length: 353)
Name: NF3424_high_10
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 335; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 55589 - 55255
Alignment:
| Q |
1 |
ctatggtttcagcagctgttatggagaaaaagagaagggatgcagctgtgaacctgaaccaaactctgtccatattttggattacaccacaattcataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55589 |
ctatggtttcagcagctgttatggagaaaaagagaagggatgcagctgtgaacctgaaccaaactctgtccatattttggattacaccacaattcataat |
55490 |
T |
|
| Q |
101 |
atttggtttgtcagagatgtttactgcagttggcctcattgagttcttctacaaacagtccttgaaagggatgcagacattcttcactgccatcacatat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55489 |
atttggtttgtcagagatgtttactgcagttggcctcattgagttcttctacaaacagtccttgaaagggatgcagacattcttcactgccatcacatat |
55390 |
T |
|
| Q |
201 |
tgctcctattcatttggattttatctcagctcactattggtttctttggtgaataaaatcacttcaacttctagtggtggtggtggttggcttcatgaca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55389 |
tgctcctattcatttggattttatctcagctcactattggtttctttggtgaataaaatcacttcaacttctagtggtggtggtggttggcttcatgaca |
55290 |
T |
|
| Q |
301 |
acaatctgaacaaagacaaacttgaccttttctat |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
55289 |
acaatctgaacaaagacaaacttgaccttttctat |
55255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University