View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_high_18 (Length: 241)
Name: NF3424_high_18
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_high_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 54 - 165
Target Start/End: Complemental strand, 10503625 - 10503514
Alignment:
| Q |
54 |
tatattaaaaaccgtggctaattgtgttcaatagattatgataacttatcgtatttattagccataaactgaacatagatactcacatattaaattgtgt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10503625 |
tatattaaaaaccgtggctaattgtgttcaatagattatgataacttatcgtatatattagccataaactgaacatagatactcacatattaaattgtgt |
10503526 |
T |
|
| Q |
154 |
taaccctccctt |
165 |
Q |
| |
|
||||| |||||| |
|
|
| T |
10503525 |
taaccatccctt |
10503514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 10504116 - 10504080
Alignment:
| Q |
10 |
aagaatattatggttaataatattcaaaatatttgat |
46 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10504116 |
aagaaaattatggttaataatattcaaaatatttgat |
10504080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University