View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3424_high_19 (Length: 232)
Name: NF3424_high_19
Description: NF3424
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3424_high_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 14 - 232
Target Start/End: Original strand, 25576032 - 25576250
Alignment:
| Q |
14 |
atcagtcttttctgtcttcaacaaataaaatccagcttaattcaaaaaactcatccactaatggcgctgcgcttaagtcagtggatcatttggttgctcg |
113 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25576032 |
atcagtctttactgtcttctccaaataaaatccagcttaattcaaaaagctcatccactaatggcgctgcgcttaagccagtggatcatttggttgctcg |
25576131 |
T |
 |
| Q |
114 |
gggacaagggattgacagtacaatggaattggagaatttacaaaccaaggactcagatattgctgtaaatggacaagctgtagtgtccactacagcggtg |
213 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25576132 |
gggacaagggattggcagtacaatggaattggagaatttacaatccaaggactcagatattgctgtaaatggacaagctgtagtgtccactacagcggtg |
25576231 |
T |
 |
| Q |
214 |
gatgccacggtaaaggacc |
232 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
25576232 |
gatgccacgctaaaggacc |
25576250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University